CREMA TRATTAMENTO PSORIASI OFFERTA -50% !

Home Blog Page 267

Psorilax:Dove trovare online |elidel crema per psoriasi intima

0

Psorilax: prezzo, funziona, recensioni, opinioni, come si usa

Una recente revisione sistematica della letteratura ha confermato che le terapie biologiche possono riattivare il virus dell'epatite B (HBV) nei pazienti con psoriasi a placche.1 Sebbene lo studio abbia scoperto che qualsiasi precedente esposizione all'HBV era associata al rischio di riattivazione virale, i pazienti con HBV cronica avevano molte più probabilità di sperimentare la riattivazione rispetto a quelli con evidenza di esposizione all'HBV ma senza epatite. La profilassi antivirale ha notevolmente ridotto il rischio di riattivazione virale nella coorte cronica dell'HBV.1 I risultati dello studio sottolineano l'importanza dello screening di tutti i pazienti con psoriasi per l'infezione da HBV prima di prescrivere un farmaco biologico o altra terapia immunosoppressiva.1,2

Screening per l'esposizione al virus dell'epatite B.

In tutto il mondo, circa 2 miliardi di persone sono state esposte all'HBV e oltre 350 milioni vivono con l'HBV cronico.2,3 Negli Stati Uniti, ogni anno vengono diagnosticati 21.000 casi di HBV e tra 850.000 e 2,2 milioni di persone hanno HBV cronico.4 Pertanto, la maggior parte dei dermatologi incontrerà pazienti con psoriasi che sono stati o saranno esposti all'HBV. Tutti gli agenti immunosoppressori (biologici e non biologici) sono associati ad un aumentato rischio di riattivazione dell'epatite e molti agenti usati per trattare la psoriasi hanno effetti immunomodulatori.2 Inoltre, alcuni trattamenti per la psoriasi sono potenzialmente epatotossici.1-3 Pertanto, gli esperti raccomandano di sottoporre a screening tutti i pazienti con psoriasi per infezione da HBV prima di iniziare la terapia immunosoppressiva.1-3 I rapporti dei pazienti sull'esposizione all'epatite sono inaffidabili perché molte persone eliminano il virus senza mai rendersi conto di essere infetti.

Come minimo, i pazienti devono essere sottoposti a screening per i seguenti marcatori sierologici: antigene di superficie dell'epatite B (HBsAG), anticorpo di superficie dell'epatite B (anti-HBs o HBsAb) e anticorpo totale dell'epatite B (anti-HBc o HBcAb).2 I risultati sierologici vengono combinati per identificare le diverse fasi dell'infezione da HBV (vedere la tabella).5 I pazienti senza evidenza di esposizione all'HBV sono considerati “sensibili” e devono essere inoculati contro l'HBV prima di iniziare la terapia immunosoppressiva.2 Una vaccinazione di richiamo deve essere presa in considerazione per i pazienti che sono stati vaccinati ma che hanno un titolo HBsAb <10 mIU / mL, indicando la mancata risposta alla vaccinazione.2 I pazienti che hanno riscontrato un'infezione da HBV acuta o cronica devono essere indirizzati a un epatologo per la valutazione e ulteriori test prima di iniziare la terapia immunosoppressiva.2

Terapia biologica e riattivazione dell'epatite B.

I medici in genere preferiscono i nuovi agenti biologici per la gestione dei pazienti con psoriasi con disfunzione epatica perché sono meno epatotossici rispetto agli agenti immunosoppressori più vecchi come il metotrexato e la ciclosporina.1-3 Classi di agenti biologici usati per trattare la psoriasi includono inibitori del fattore di necrosi tumorale (TNF) -α e anticorpi monoclonali che bloccano varie interleuchine (IL).1

Gli studi condotti su pazienti con HBV cronico e artrite reumatoide o malattia di Crohn hanno collegato gli inibitori del TNF-a ad un alto rischio di riattivazione dell'HBV.6,7 Il meccanismo alla base della riattivazione dell'HBV non è chiaro, sebbene l'evidenza degli studi in vitro e in vivo suggerisca che il blocco del TNF-α comprometta la capacità del sistema immunitario di eliminare il virus.6 L'inibizione del TNF-α può anche migliorare la replicazione dell'HBV.

Sebbene non esista una definizione universale di riattivazione dell'HBV, viene comunemente definita come “un aumento della replicazione dell'HBV di almeno 1 log 10 copie / mL o la conversione del DNA dell'HBV sierico da negativo a positivo.”1 Subito dopo la reazione dell'HBV, i pazienti che presentavano uno screening positivo per HBsAG mostreranno un aumento dei livelli sierici di HBV-DNA, mentre i pazienti che inizialmente presentavano uno screening negativo per HBsAg o avevano un livello sierico non rilevabile di HBV-DNA verranno sottoposti a screening positivo per HBsAG o HBV-DNA sierico .6

Le conseguenze della riattivazione dell'HBV sono potenzialmente gravi. Sebbene alcuni pazienti possano manifestare nient'altro che un aumento asintomatico degli enzimi epatici sierici, altri possono sviluppare un'epatite grave o soffrire di insufficienza epatica potenzialmente fatale.8 La mitigazione della lesione epatica dipende dalla diagnosi precoce e dalla gestione appropriata, che può includere la terapia immunosoppressiva e l'inizio della terapia antivirale.6

Quantificazione del rischio di riattivazione dell'epatite B nei pazienti con psoriasi mediante terapia biologica

L'esame più completo del rischio di riattivazione dell'epatite nei pazienti con psoriasi trattati con terapia biologica è stata un'analisi sistematica che comprendeva 49 studi (3 virus dell'epatite C (HCV), 46 HBV): 1 prospettico, 15 retrospettivi e 33 serie o rapporti di casi.1 Le terapie biologiche utilizzate negli studi includevano gli inibitori del TNF-α etanercept (53%), adalimumab (22%), infliximab (8%) e golimumab (0,3%); il bloccante IL-12/23 ustekinumab (13%); il secukinumab bloccante IL-17 (0,9%); e 2 prodotti biologici non più commercializzati (alefacept ed efalizumab).1

Cumulativamente, gli studi hanno incluso 215 pazienti con psoriasi da moderata a grave ampiamente classificati come affetti da HBV cronico (n = 40) o come sieropositivi per HBV ma senza epatite attiva (n = 175).1 Quest'ultimo gruppo consisteva principalmente di pazienti con infezione da HBV passata risolta, ma potrebbe aver incluso alcuni che avevano avuto un'infezione da HBV occulta o un risultato anti-HBc falso positivo.1

Nella coorte cronica di HBV, il 20% dei pazienti (8/40) ha avuto una riattivazione dell'HBV, che si è tradotta in un tasso di riattivazione annuale del 14%.1 Stratificare i pazienti con HBV cronico secondo l'uso della profilassi antivirale ha prodotto un tasso di riattivazione molto più basso per i pazienti che hanno ricevuto la profilassi (3/26) rispetto a quelli che non lo hanno fatto (5/14; 12% contro 36%, rispettivamente); i tassi di riattivazione annuali erano rispettivamente del 7,7% vs 26%.1 Il tasso di riattivazione per i pazienti che erano positivi per l'anti-HBc ma che non avevano l'epatite era dell'1% (2/175) e il tasso di riattivazione annuale era trascurabile dello 0,32%.1

La revisione ha diverse imitazioni, tra cui la decisione degli autori di non stratificare i risultati per uso biologico, la mancanza di studi randomizzati controllati e la qualità incoerente degli studi incorporati.1 I risultati supportano la sicurezza delle terapie biologiche per i pazienti con precedente esposizione all'HBV che non hanno l'HBV cronico, tuttavia, e suggeriscono che questi pazienti potrebbero non richiedere la profilassi.

È possibile che il rischio di riattivazione virale differisca tra gli inibitori del TNF-α e che inibitori più potenti possano comportare un rischio maggiore.9,10 Ad esempio, i tassi di riattivazione dell'HBV riportati nei pazienti positivi all'HBsAg trattati con inibitori del TNF-α più potenti infliximab, adalimumab o certolizumab variano dal 12% al 39% rispetto all'1% al 5% con etanercept.10 Tuttavia, questi intervalli combinano i tassi osservati nei pazienti trattati per condizioni diverse e non possono essere estrapolati in modo affidabile ai pazienti con psoriasi. Inoltre, compromettere l'affidabilità delle valutazioni del rischio tra gli inibitori del TNF-a è il fatto che la maggior parte dei tassi di incidenza provengono da casi clinici o studi retrospettivi e non da studi ben condotti.9

I bloccanti di IL sono nuovi agenti usati per trattare la psoriasi e si sa meno su come influenzano il rischio di riattivazione dell'HBV con un uso prolungato in pazienti con psoriasi. In un piccolo studio con ustekinumab in pazienti con concomitante psoriasi ed esposizione a HBV, 2 su 7 pazienti con HBV cronica che non hanno ricevuto la profilassi antivirale hanno sperimentato la riattivazione dell'HBV (29%) rispetto a nessun paziente che aveva avuto HBV occulto o che hanno ricevuto profilassi antivirale.11 Il gruppo di studio della Società europea di microbiologia clinica e malattie infettive (ESCMID) ha condotto revisioni dei tassi di malattie infettive associate a varie interleuchine, immunoglobuline e fattori di complemento che includevano numerosi bloccanti IL approvati per la psoriasi a placche negli Stati Uniti o nell'Unione europea.12 Il gruppo ha concluso che ustekinumab era associato a un basso rischio di riattivazione dell'HBV, ma che i bloccanti IL-17 secukinumab, ixekizumab o brodalumab non aumentavano il rischio di riattivazione dell'HBV.12 Un avvertimento è che alcuni studi sui bloccanti dell'IL-17, inclusi gli studi di fase 3 per ixekizumab in pazienti con psoriasi, hanno escluso le persone con HBV cronico, i cui dati mostrano un rischio più elevato di riattivazione virale con l'uso di immunosoppressori.13

Conclusione

Nei pazienti con psoriasi precedentemente esposti all'HBV o che hanno l'HBV cronico, le terapie immunosoppressive possono causare riattivazione virale, sebbene il rischio sia minimo per i pazienti con infezione risolta o occulta. Gli studi hanno associato terapie sia biologiche che biologiche con un rischio di riattivazione. Pertanto, lo screening è consigliato per tutti i pazienti con psoriasi che contemplano il trattamento con un agente immunosoppressivo e il monitoraggio della carica virale dell'HBV in pazienti che sono anti-HBC positivi ma HBsAG-negativi. Sebbene gli agenti biologici siano sicuri da usare in pazienti con psoriasi con HBV cronico, il trattamento deve essere intrapreso in consultazione con un epatologo e questi pazienti devono essere monitorati per segni di riattivazione virale. Sono necessari studi prospettici su larga scala per comprendere meglio il rischio di riattivazione dell'HBV in pazienti con psoriasi sottoposti a trattamento con terapie biologiche e per confrontare il rischio di riattivazione tra diverse terapie biologiche.

Riferimenti

  1. Snast I, Atzmony L, Braun M, Hodak E, Pavlovsky L. Rischio di riattivazione del virus dell'epatite B e C in pazienti con psoriasi su terapie biologiche: uno studio di coorte retrospettivo e una revisione sistematica della letteratura. J Am Acad Dermatol. 2017; 77 (1): 88-97.
  2. Motaparthi K, Stanisic V, Van Voorhees AS, Lebwohl MG, Hsu S. Dal consiglio medico della National Psoriasis Foundation: raccomandazioni per lo screening per l'infezione da epatite B prima di iniziare gli inibitori del fattore-alfa necrosi antitumorale o altri agenti immunosoppressori nei pazienti con la psoriasi. J Am Acad Dermatol. 2014; 70 (1): 178-186.
  3. Fiore M, Leone S, Maraolo AE, Berti E, Damiani G. Malattia epatica e pazienti psoriasici. Biomed Res Int. 2018; 2018: 3.140.983.
  4. Centri per il controllo e la prevenzione delle malattie. Epatite virale: statistica e sorveglianza. Aggiornato il 18 aprile 2018. Accesso al 28 aprile 2018.
  5. Centri per il controllo e la prevenzione delle malattie. Interpretazione dei risultati dei test sierologici dell'epatite B. Accesso effettuato il 28 aprile 2018.
  6. Cannizzaro MV, Franceschini C, Esposito M, Bianchi L, Giunta A. Riattivazione dell'epatite B in pazienti con psoriasi trattati con agenti anti-TNF: prevenzione e gestione. Psoriasi (Auckl). 2017; 7: 35-40.
  7. Vilarrasa E, Puig L. Psoriasi: trattamento biologico e malattie del fegato. World J Dermatol. 2014; 3 (4): 76-85.
  8. Visram A, Feld JJ. Definizione e classificazione della riattivazione dell'HBV. Malattia epatica clinica. 2015; 5 (2): 35-38.
  9. Bessone F, Dirchwolf M. Gestione della riattivazione dell'epatite B in pazienti immunodepressi: un aggiornamento sulle raccomandazioni attuali. World J Hepatol. 2016; 8 (8): 385-394.
  10. Loomba R, Liang TJ. Riattivazione dell'epatite B associata a terapie immunosoppressive e con modificatori biologici: concetti attuali, strategie di gestione e direzioni future. Gastroenterologia. 2017; 152 (6): 1297-1309.
  11. Chiu HY, Chen CH, Wu MS, Cheng YP, Tsai TF. Profilo di sicurezza di ustekinumab nel trattamento di pazienti con psoriasi ed epatite B o C. concomitante Br J Dermatol. 2013; 169 (6): 1295-1303.
  12. Winthrop KL, Mariette X, Silva JT, et al. Documento di consenso del Gruppo di studio ESCMID per le infezioni negli ospiti compromessi (ESGICH) sulla sicurezza delle terapie mirate e biologiche: una prospettiva di malattie infettive (molecole di effettori immunitari solubili (II): agenti che prendono di mira interleuchine, immunoglobuline e fattori del complemento) (pubblicato online il 2 febbraio 2018). Clin Microbiol Infect. doi: 10.1016 / j.cmi.2018.02.002.
  13. Papp KA, Bachelez H, Blauvelt A, et al. Infezioni da sette studi clinici di ixekizumab, un anticorpo monoclonale anti-interleuchina-17A, in pazienti con psoriasi da moderata a grave. Br J Dermatol. 2017; 177 (6): 1537-1551.

Psorilax:in vendita |crema psoriasi unifarco

0

Psorilax: prezzo, funziona, recensioni, opinioni, dove si compra

Una volta attivata, una cellula immunitaria rivede il suo metabolismo, apportando modifiche che potrebbero essere sfruttate per il trattamento.

Spectrum Science Communications

Di Mitch Leslie

Circa 12 anni fa, Gary Glick e sua moglie hanno notato qualcosa di sbagliato nel loro figlio, Jeremy. Sembrava in ritardo rispetto alla sorella gemella, ricorda l'immunologo e biologo chimico dell'Università del Michigan ad Ann Arbor. “Stavano crescendo all'unisono e si è quasi fermato.” Jeremy, che all'epoca aveva 9 o 10 anni, sembrava anche malato e pallido e cominciò a lamentarsi di dolori fastidiosi allo stomaco e altrove.

Rachel Lipson Glick, un medico, era sconcertata dal misterioso disturbo del figlio. Così erano altri dottori. Ci sono voluti circa 3 anni per escludere una miriade di tumori, malfunzionamenti endocrini e altre potenziali cause e per determinare che Jeremy aveva la malattia di Crohn, un'infiammazione del tratto digestivo alimentata da cellule immunitarie che si comportavano male.

La diagnosi ha reso la vita più difficile per Jeremy, ora 22enne e senior al college. Per controllare i sintomi, inietta il farmaco anticorpale adalimumab (Humira). Probabilmente ne avrà bisogno, o un altro trattamento di inibizione immunitaria, per il resto della sua vita.

Per coincidenza, una di quelle alternative potrebbe derivare dal lavoro di suo padre. Gary Glick, come un numero crescente di altri ricercatori, è convinto che le condizioni di guida delle cellule immunitarie come la malattia di Crohn condividano una caratteristica che potrebbe essere la loro rovina: il loro metabolismo. Ha trascorso gli ultimi 2 decenni alla ricerca di farmaci mirati agli adattamenti metabolici delle cellule immunitarie. Gli studi clinici condotti da Lycera, una società fondata da Glick, stanno ora valutando il primo di quei farmaci per la psoriasi e la colite ulcerosa, una malattia intestinale correlata alla malattia di Crohn.

Le compagnie farmaceutiche stanno lavorando per sviluppare altri candidati. I ricercatori stanno anche cercando di distribuire farmaci esistenti che alterano il metabolismo, come i trattamenti per il diabete con metformina e 2-desossiglucosio (2DG). “È un momento molto emozionante”, afferma l'immunologo Jonathan Powell della School of Medicine della Johns Hopkins University di Baltimora, nel Maryland. “Potenzialmente, tutte le malattie immunologiche sono bersagli per la terapia metabolica.”

I ricercatori sul cancro hanno anche cercato di interrompere il metabolismo cellulare, anche testando alcuni degli stessi farmaci che gli immunologi stanno studiando. Ma molti scienziati sono convinti che la strategia funzionerà meglio per le malattie immunitarie che per i tumori perché i farmaci per curare queste malattie devono solo sopprimere un numero relativamente piccolo di cellule sovraesuberanti, non eliminarle. E mentre i farmaci esistenti che frenano le cellule immunitarie, come adalimumab, possono compromettere le nostre difese contro i patogeni, Glick e altri scienziati ritengono che l'inconveniente non influirà sulla loro strategia. Concentrandosi sul metabolismo delle cellule immunitarie iperattive, dice, offre “un modo per colpire direttamente queste cellule risparmiando la funzione immunitaria”.

Gary Glick (a sinistra) ha scoperto un farmaco che potrebbe portare a un trattamento per la malattia autoimmune che colpisce suo figlio Jeremy (a destra).

© Joe McNally

Negli anni 1920, il medico e chimico tedesco Otto Warburg fu il primo a rendersi conto che le cellule immunitarie hanno un modo distintivo di alimentarsi. Per alimentare le loro attività, le cellule devono produrre la molecola di adenosina trifosfato (ATP). Possono farcela direttamente attraverso la glicolisi, un percorso biochimico che smuove il glucosio. Oppure possono generare ATP attraverso un processo più coinvolto chiamato fosforilazione ossidativa, che richiede molecole cariche di energia prodotte dalla glicolisi ma ravviva anche altre reazioni biochimiche che degradano gli acidi grassi e gli aminoacidi come la glutammina.

Le cellule del corpo normali in genere si basano sulla fosforilazione ossidativa per la maggior parte dei loro bisogni energetici, ma Warburg ha scoperto che le cellule tumorali aumentavano la glicolisi. Ha anche notato che alcune cellule sane dipendevano dalla glicolisi: cellule immunitarie.

Warburg era sulla buona strada, ma i ricercatori ora sanno che quando le cellule immunitarie non combattono i patogeni, riducono il loro metabolismo e producono ATP principalmente attraverso la fosforilazione ossidativa. L'arrivo di una minaccia, come un virus influenzale che si riproduce nei polmoni, attiva le cellule, galvanizzandole per combattere l'invasore. A quel punto, “subiscono questi enormi cambiamenti metabolici”, afferma l'immunologa Erika Pearce del Max Planck Institute of Immunobiology and Epigenetics di Friburgo, in Germania. Le cellule stimolate non richiedono solo più energia, osserva. Una cellula T attivata può dividersi più volte al giorno, generando rapidamente un esercito di milioni di discendenti. Per sostenere tale mobilitazione, le cellule richiedono anche grandi quantità di materie prime, come i precursori di DNA, proteine ​​e lipidi.

Come esattamente una cellula immunitaria attivata soddisfi la sua enorme richiesta di energia e materiale molecolare dipende dal tipo di cellula che è. Le cellule T helper attivate, che fungono da comandanti immunitari, sembrano seguire il paradigma di Warburg. Misurano il glucosio e aumentano la glicolisi, sebbene aumentino anche il tasso di fosforilazione ossidativa di una quantità minore e consumino più glutammina. Le cellule T citotossiche, che uccidono le cellule tumorali e le cellule soggette a virus, assumono una presa simile. Al contrario, le cellule T regolatorie che sopprimono il sistema immunitario continuano a trarre la maggior parte della loro energia dalla fosforilazione ossidativa, anche dopo che entrano in azione e preferiscono gli acidi grassi rispetto agli aminoacidi e al glucosio.

Le cellule immunitarie fanno anche diverse scelte metaboliche a seconda che si tratti di cellule della memoria, che persistono per anni e ci proteggono dallo ammalarsi dallo stesso patogeno più di una volta, o da cellule effettrici di breve durata specializzate ad attaccare immediatamente i microbi. Le cellule T di memoria, ad esempio, in genere favoriscono la fosforilazione ossidativa e consumano acidi grassi. Le cellule T effettrici, al contrario, aumentano la glicolisi e sono forti utilizzatori di glucosio, una differenza riflessa nei loro mitocondri, gli organelli che fungono da centrali elettriche cellulari, come riportato da Pearce e dai suoi colleghi 2 anni fa.

Risorse di energia alternativa

Le cellule immunitarie attivate cambiano ciò che consumano e quale via metabolica usano per abbattere quel carburante per produrre ATP che trasporta energia. Alcuni tipi si caricano di glucosio, aumentando la glicolisi e consumano più glutammina. Gli acidi grassi rimangono un alimento base per altre cellule, che dipendono ancora dalla fosforilazione ossidativa.



ATP ATP ATP ATP Trifosfato di adenosina mitocondrio Glucosio

Helper T cell

Cellula T citotossica

Cellula T regolatoria

Cellula B. Cella di memoria B o T.

La glicolisi Ripartizione della glutammina Ossidazione degli acidi grassi ciclo di Krebs ossidativofosforilazione glutammina Acidi grassi Cellula Materiali grezzi Glucosio Aumenta l'assunzione Ridurre l'assunzione glutammina Acidi grassi N 0 0 0 0 N 0

Sebbene le cellule T della memoria “abbiano questi mitocondri belli, intatti, filiformi”, dice, le cellule T effettrici tritano i loro mitocondri. Gli organelli sono i luoghi in cui avviene la fosforilazione ossidativa e la loro rottura può rendere meno efficiente la via metabolica e promuovere la glicolisi, suggeriscono i ricercatori.

Gli adattamenti metabolici consentono alle cellule immunitarie di svolgere i loro ruoli protettivi, ma a volte portano a malfunzionamenti delle cellule. Nell'artrite reumatoide, ad esempio, le cellule T attivate scivolano nelle articolazioni, afferma l'immunologa Cornelia Weyand dell'Università di Stanford a Palo Alto, in California. “A loro piace lì, e rimangono e causano infiammazione cronica dei tessuti.”

Tale comportamento riflette un cambiamento nel metabolismo. Come altre cellule T attivate, le cellule T implicate nell'artrite reumatoide si basano sulla glicolisi. Ma modificano quel percorso per rendere meno ATP e più precursori molecolari necessari per supportare la loro rapida divisione. Di conseguenza, le cellule T sono a corto di specie reattive dell'ossigeno – molecole di segnalazione chiave che controllano il loro comportamento – e diventano canaglia. Accelerano la loro riproduzione e si specializzano in varietà che promuovono l'infiammazione.

Le cellule diventano anche ginnaste migliori, abili a strisciare attraverso spazi ristretti nelle articolazioni. Weyand e i suoi colleghi hanno scoperto che le cellule T anomale hanno prodotto delle increspature sulle membrane cellulari che hanno permesso loro di penetrare più a fondo nei tessuti. All'interno dell'articolazione, le cellule T mobili aiutano a stimolare altre cellule a formare una lesione che ricorda una ferita non cicatrizzante, afferma Weyand, e che provoca dolore e ulteriore deterioramento dell'articolazione. “Il metabolismo della cellula controlla il suo comportamento e il suo comportamento non è buono per il paziente”, afferma.

Pearce afferma che la prospettiva di intromettersi con il metabolismo delle cellule immunitarie per curare le malattie spaventa alcuni dei suoi colleghi, che temono di paralizzare l'intero sistema di difesa del corpo o di danneggiare altre cellule vitali. “Se dai un inibitore della glicolisi, non ucciderà qualcuno?” le chiedono. Ma l'immunologo Jeff Rathmell del Vanderbilt University Medical Center di Nashville afferma che solo una piccola parte delle cellule immunitarie – e delle cellule del corpo in generale – aumenta il loro uso di tali percorsi e sarebbe influenzata dai farmaci che alterano il metabolismo. “Alla maggior parte delle cellule non importa.”

Il lavoro sugli animali suggerisce che il targeting del metabolismo immunitario è un approccio promettente. In uno studio del 2015, l'immunologa Laurence Morel dell'Università della Florida a Gainesville e colleghi hanno dosato topi che sono stati geneticamente modificati per sviluppare una condizione simile al lupus con metformina e 2DG. La metformina riduce la fosforilazione ossidativa, mentre il 2DG sopprime la glicolisi. Insieme, le molecole hanno invertito i sintomi del lupus negli animali. I pazienti con lupus, ad esempio, pompano anticorpi che attaccano il proprio DNA. Ma nei topi, i livelli di quegli anticorpi sono diminuiti di circa il 50% dopo l'inizio del trattamento. I ricercatori non hanno rilevato segni che i roditori siano diventati più vulnerabili alle infezioni.

In un altro studio, Rathmell e colleghi hanno aggiunto il dicloroacetato, che sopprime la glicolisi, all'acqua potabile dei topi che hanno una condizione che imita la sclerosi multipla, in cui il sistema immunitario attacca la guaina mielinica isolante dei nervi. Il composto ha impedito la distruzione della mielina negli animali e ridotto i sintomi neurologici come la debolezza muscolare, hanno riferito gli scienziati nel 2014.

Anche il metabolismo cellulare che ostacola potrebbe frenare gli attacchi del sistema immunitario agli organi trapiantati, hanno scoperto Powell e colleghi. Hanno dato metformina, 2DG e un terzo farmaco che blocca il metabolismo della glutammina nei topi che avevano ricevuto innesti di pelle o trapianti di cuore. Gli innesti di pelle sono sopravvissuti circa quattro volte più a lungo nei topi trattati rispetto agli animali di controllo, il che ha rapidamente respinto il tessuto. I cuori trapiantati hanno anche funzionato molto più a lungo nei topi che hanno ricevuto il trio di droga, ha riferito il team nel 2015 Rapporti cellulari.

I pochi studi clinici che hanno testato il concetto nelle persone hanno utilizzato principalmente composti già approvati come la metformina. Due anni fa, i ricercatori argentini hanno riportato un minor numero di nuove lesioni cerebrali in 30 pazienti con sclerosi multipla che hanno assunto metformina o un altro farmaco che cortocircuita la fosforilazione ossidativa. Uno studio clinico condotto da ricercatori cinesi sta testando se la metformina può sedare i razzi del lupus. E finora, tali droghe sembrano sicure. “La metformina da sola fa ben poco per ridurre l'immunità, ad esempio, ma può ridurre l'infiammazione cronica”, afferma Rathmell.

Gli scettici osservano che i ricercatori hanno anche cercato di riutilizzare la metformina e il 2DG per bloccare il metabolismo nelle cellule tumorali, con risultati incoerenti. Tuttavia, Powell e altri scienziati affermano di non essere scoraggiati. Contrariamente alle cellule tumorali, “In realtà non è necessario uccidere una cellula (immune) per modificarne il metabolismo”, afferma Rathmell.

Questi farmaci non sono stati progettati per modificare il metabolismo delle cellule immunitarie, aggiunge il biologo del cancro Ralph DeBerardinis del Southwestern Medical Center dell'Università del Texas a Dallas. “Non dovremmo essere sorpresi se non hanno la potenza o la specificità per avere un effetto significativo.”

Non è necessario uccidere una cellula (immune) per modificarne il metabolismo

Jeff Rathmell, Centro medico dell'Università di Vanderbilt

Alcuni scienziati pensano che parlare di trattamenti sia prematuro. Inibire le reazioni che producono energia delle cellule immunitarie in una malattia cronica “è un'idea allettante”, afferma il biologo mitocondriale Navdeep Chandel della Feinberg School of Medicine della Northwestern University a Chicago, Illinois. Ma sostiene che i ricercatori non capiscono abbastanza bene il metabolismo delle cellule immunitarie da sapere come intervenire in modo sicuro ed efficace.

Eppure uno studio pubblicato online questa settimana in Scienza fornisce un maggiore supporto che inibire il metabolismo immunitario può placare le malattie umane. Il lavoro si concentra su un farmaco, dimetilfumarato, che ha già ricevuto l'approvazione dalla Food and Drug Administration degli Stati Uniti come trattamento per la sclerosi multipla. Sebbene i ricercatori sapessero che il farmaco sopprime le cellule immunitarie, non erano sicuri di come. Un team guidato da scienziati di John Hopkins riferisce ora che il composto paralizza un enzima necessario per la glicolisi, rafforzando l'idea che il percorso possa essere preso di mira dai farmaci.

Glick è fiducioso che lui e gli altri siano impegnati in qualcosa. Il composto che ha scoperto risale alla ricerca che iniziò a metà degli anni '90. “In un certo senso ho sostenuto”, dice. Glick e i suoi colleghi erano alla ricerca di composti che uccidessero le cellule B, le cellule produttrici di anticorpi che aiutano a causare i sintomi del lupus. Dopo aver testato diversi composti, ne hanno trovato uno che ostacola un enzima necessario per la fosforilazione ossidativa.

Lycera sta valutando una versione migliorata di quella molecola nelle persone con psoriasi o colite ulcerosa in parte perché è più facile testare farmaci su quelle malattie che sul lupus, i cui sintomi influenzano più organi e sono più difficili da rintracciare. A differenza dell'adalimumab che Jeremy Glick inietta, questo farmaco può essere assunto sotto forma di pillola. Lycera prevede di annunciare i risultati delle sue due prove entro la fine dell'anno.

Questo mese, una nuova società fondata da Gary Glick ha avviato studi clinici su un farmaco antiparassitario esistente, la niclosamide, in pazienti con colite ulcerosa. La niclosamide, che uccide la tenia inibendo la fosforilazione ossidativa, ha un lungo record di sicurezza, osserva Glick. “È approvato per i bambini e le donne in gravidanza”, afferma.

Glick era alla ricerca di composti che aggiustassero il metabolismo delle cellule immunitarie anni prima che a suo figlio venisse diagnosticata la malattia di Crohn, ma afferma che la malattia di Jeremy forniva una motivazione in più. “Se potesse svegliarsi ogni mattina e prendere una pillola inventata da papà, sarebbe elettrizzato”, dice Glick.

Psorilax:Tutorial gratuito |la migliore crema contro la psoriasi

0

Psorilax: prezzo, funziona, recensioni, opinioni, come si usa

p38α signaling in psoriasis

Psoriasis is an autoimmune skin condition that is linked to the proinflammatory cytokines IL-23, which triggers epidermal hyperplasia, and IL-17, which is produced by T cells in the skin. Zheng et al. found that p38α signaling specifically in skin-resident dendritic cells known as Langerhans cells was important for the pathogenesis of psoriasis in a mouse model of the disease. p38α signaling in Langerhans cells stimulated the production of IL-23, which is critical for the development of IL-17–producing T cells that are implicated in the disease. Genetic deletion or pharmacological inhibition of p38α reduced skin inflammation in mice with established psoriatic disease. Together, these data identify an important cellular source of pathogenic IL-23 and suggest that p38α in skin-resident Langerhans cells could be targeted to treat psoriasis.

Abstract

Dendritic cells (DCs) contribute to psoriasis pathogenesis. In a mouse model of imiquimod-induced psoriasiform skin inflammation, we found that p38α activity in Langerhans cells (LCs), a skin-resident subset of DCs, promoted the generation of T cells that produce IL-17, a proinflammatory cytokine that is implicated in autoimmune disease. Deletion of p38α in LCs, but not in other skin or circulating DC subsets or T cells, decreased T cell–mediated psoriasiform skin inflammation in mice. The activity of p38α in LCs specifically promoted IL-17 production from γδ and CD4+ T cells by increasing the abundance of IL-23 and IL-6, two cytokines that stimulate IL-17 secretion. Inhibition of p38 activity through either pharmacological inhibition or genetic deletion also reduced the severity of established psoriasiform skin inflammation. Together, our findings indicate a critical role for p38α signaling in LCs in promoting inflammatory responses in the skin and suggest that targeting p38α signaling in LCs may offer an effective therapeutic approach to treat psoriasis.

INTRODUCTION

Psoriasis is a common chronic inflammatory skin disease characterized by epidermal hyperplasia, erythematous plaque formation, and the inflammatory cell infiltration in the dermis and epidermis (1, 2). Psoriasis is traditionally regarded as a local skin disease, but it is also associated with many systemic inflammatory diseases, such as diabetes and cardiovascular disease (3). The etiology and pathogenesis of psoriasis are not fully understood, and accumulating evidence indicates that immune dysfunction plays pivotal roles in disease development (3, 4). Psoriasis was initially classified as a disease mediated by the T helper type 1 (TH1) cell response; however, cytokines released by interleukin-17 (IL-17)–producing T cells such as IL-17, tumor necrosis factor–α (TNFα), IL-23, and IL-22 appear to be critical for the development of psoriasis (3, 57). Many of these cytokines are increased in psoriasis skin lesions (2, 8), and many psoriasis patients have been effectively treated by using a new generation of drugs that selectively target TNFα, IL-23, and IL-17 (9). Although these cytokine antagonists provide higher efficacy, they can cause adverse side effects, such as increased risk of serious infection, cardiovascular disorders, and cancer development in psoriasis patients (10). The TNFα antagonist paradoxically induces new onset psoriasis or aggravates preexisting quiescent psoriatic disease by an unknown mechanism (11). Moreover, these antagonist treatments are costly, and the responses are variable between different psoriasis patients (10). Thus, therapeutic responses could be improved by characterization of the upstream cellular and molecular mechanisms that regulate generation of IL-17–producing T cells during psoriasis pathogenesis.

Dendritic cells (DCs) are the key sentinels of the immune system that bridge innate and adaptive immunity (12) and are critical for the development of psoriasis (13). DCs are a highly heterogeneous population, and different tissues have different DC subsets with different functions (14). Although much effort has been made to identify the precise taxonomy for skin DCs, the current classification for skin DC subsets is still somewhat complicated. There are at least three subsets of DCs in the steady-state human and mouse skin: epidermal Langerhans cells (LCs), dermal myeloid DCs (dDCs), and plasmacytoid DCs (pDCs) (15, 16). According to their surface expression of langerin, mouse dDCs can be further divided into langerin+ dDCs and langerin dDCs (17). Under steady state, langerin+ dDCs are recruited from the blood to the dermis as well as capture tissue antigens and present these antigens to naïve T cells in the draining lymph nodes (DLNs) (17).

In an imiquimod (IMQ)–induced psoriasis-like dermatitis (18), IL-23 produced by either langerin dDCs or LCs drives psoriatic plaque formation in mice (19, 20). Moreover, in an IL-23–induced psoriasis-like mouse skin inflammation (21), monocyte-derived inflammatory LCs and dDCs mediate the disease pathogenesis (22). DC-specific deletion of ABIN-1 (A20 binding and inhibitor of nuclear factor κB 1) restricts Toll-like receptor–induced IL-23 production and protects mice from IMQ-induced psoriasis (23). IL-36 mediates the DC-keratinocyte (KC) cross-talk in an IMQ-induced psoriasiform dermatitis by regulating the IL-23/IL-17/IL-22 pathway, but the in vivo cellular source of IL-36 in psoriasis pathogenesis still needs to be clarified (24). In addition, retinoic acid–inducible gene I (RIG-1)–antiviral signaling drives endogenous IL-23 production in DCs to further promote psoriasis-like disease (25). Thus, despite strong evidence implicating DCs in psoriasis, the intracellular signaling pathways that regulate proinflammatory cytokines in psoriasis pathogenesis remains to be established.

Increased activity of p38α mitogen-activated protein kinase, a central regulator of inflammatory responses, is associated with susceptibility to psoriasis in humans (26) and is characteristic of psoriatic skin lesions (27). p38 activity is also increased in KCs stimulated by stress stimuli, such as cytokines and ultraviolet irradiation (28). These findings indicate that targeting p38 could be a promising strategy to treat psoriasis (29). Unfortunately, p38 inhibitors have not shown efficacy in the treatment of psoriasis, and many have been withdrawn from clinical trials because of adverse side effects (28). Thus, it would be useful to define the cell types in which p38 is active in psoriasis.

Using a combination of genetic and molecular approaches, we report here that p38α deletion in LCs, but not in other DC subsets or T cells, reduced IMQ-induced psoriasiform skin inflammation. Mice with p38α-deficient LCs produced much less IL-23 and IL-6 in response to IMQ treatment. Consequently, when challenged with IMQ, mice with a DC-specific deficiency in p38α showed reduced IL-17 production from γδ and CD4+ T cells. p38α signaling in LCs specifically promoted IL-17 production in γδ and CD4+ T cells through secretion of IL-23 and/or IL-6. However, p38α signaling in LCs was dispensable for the generation of interferon-γ (IFNγ)–, IL-4–, and Foxp3-expressing T cells. Intradermal injection of IL-23 restored the skin inflammation and proinflammatory cytokine expression in mice lacking p38α in DCs. In contrast, IL-6 injection partially restored skin inflammation and proinflammatory cytokine expression. Inhibition of p38 activity also reduced the severity of an established psoriasiform skin inflammation. Thus, this study links p38α signaling in LCs and IL-23 or IL-6 with IL-17 production from γδ and CD4+ T cells, and it provides cellular and molecular mechanisms by which p38α regulates susceptibility to psoriasis.

RESULTS

Deletion of p38α in DCs ameliorates IMQ-induced psoriasiform skin disease in mice

In the IMQ-induced mouse psoriasiform skin disease model (18), p38 activity in CD45+ leukocytes was higher in IMQ-treated mouse skin than in control cream-treated mouse skin (Fig. 1A). Because p38α is the dominant p38 isoform that is expressed in immune cells (30), we generated Mapk14fl/flRosa26-Cre-ERT2 mice (referred to as “p38αCreER mice” here, as described in our previous study (30)) to determine the role of p38 in psoriasis pathogenesis and detected efficient deletion of p38α in skin tissue (fig. S1A). We explored the development of IMQ-induced psoriasiform skin inflammation in wild-type (WT) and p38αCreER mice, which were pretreated with tamoxifen to acutely delete p38α in skin tissue. We found that p38αCreER mice had reduced psoriatic symptom severity than WT mice, including ear swelling, epidermal hyperplasia, and skin inflammatory cell infiltration (Fig. 1, B and C), suggesting that p38α signaling could promote the development of IMQ-induced psoriasiform skin inflammation.

Fig. 1 Deletion of p38α in DCs reduces IMQ-induced skin inflammation in mice.

(A) Wild-type (WT) mice were topically treated with imiquimod (IMQ)–containing or control cream for two consecutive days, and the phosphorylation (p) of p38 in skin CD45+ cells was analyzed by flow cytometry (n = 6 mice per group). MFI, mean fluorescence intensity. (B and C) Tamoxifen-pretreated WT and p38αCreER mice were topically treated with IMQ for six consecutive days. Change in ear thickness (left) and disease severity score (right) were recorded (B) (n = 5 mice per group). Histopathological changes in skin tissue of WT (left) and p38αCreER (middle) mice were examined by hematoxylin and eosin (H&E) staining (n = 3 mice per group), and the marked area was magnified (right) (C). Scale bars, 200 μm. (D) p-p38 in skin dendritic cells (DCs) was analyzed by flow cytometry in WT mice topically treated with control or IMQ-containing cream for two consecutive days (n = 6 mice per group). (E to J) WT and p38αΔDC mice were treated with IMQ for six consecutive days. Change in ear thickness (left) and disease severity score (right) (E) (n = 5 mice per group), representative images of H&E staining of skin sections (n = 3 mice per group) (F), the percentages (G) and cell numbers (H) of neutrophils and macrophages in the epidermis (n = 4 mice per group), and the percentages (I) and cell numbers (J) of neutrophils and macrophages in the dermis (n = 4 mice per group). Scale bars, 200 μm. Two-sided Student’s t tests (right panels of (A), (B), (D), and (E); (G) to (J)) and two-way analysis of variance (ANOVA) (left panels of (B) and (E)) were performed, and data are means ± SEM. Data are representative of three (A to D) or four (E to J) independent experiments.

Consistent with the role of DCs in psoriasis development (13), IMQ-treated mouse skin had an increased percentage and number of DCs than control cream-treated skin (fig. S1B). In addition, p38 activity was higher in IMQ-treated skin DCs (Fig. 1D), suggesting that p38α signaling in DCs might play a pivotal role in the immune mechanisms during psoriasis development. To delineate the specific role of DC-intrinsic p38α signaling in psoriasis pathogenesis, we generated Mapk14fl/flCD11c-Cre mice (referred to as “p38αΔDC mice” here (30)). We observed efficient deletion of p38α in skin DCs (fig. S1C), which did not affect the percentages or activation status of DCs in either the epidermis or dermis (fig. S2, A and B). When treated with IMQ-containing cream, p38αΔDC mice had much less ear swelling and reduced composite psoriasis score than WT mice (Fig. 1E). Histological analysis showed that the skin of p38αΔDC mice had less epidermal hyperplasia and inflammation (Fig. 1F). Flow cytometry analysis showed that the infiltration of neutrophils and macrophages in the skin was increased after IMQ treatment (fig. S3, A and B). However, infiltration of neutrophils and macrophages into the epidermis and dermis was reduced in p38αΔDC mice (Fig. 1, G to J). Notably, the percentages and cell numbers of LCs, CD4+ T cells, and γδ T cells, which are key producers of IL-17 during psoriasis, were comparable in the epidermis of IMQ-treated WT and p38αΔDC mice (fig. S3, C and D). Furthermore, there were no significant differences in neutrophil or macrophage numbers in the spleens of IMQ-treated WT and p38αΔDC mice (fig. S3, E and F). Collectively, these findings implicate a key role for DC-mediated p38α signaling in IMQ-induced psoriatic skin disease.

p38α activity in DCs regulates the generation of IL-17–producing T cells in the skin

Consistent with the critical role of IL-17–producing T cell–mediated inflammatory responses in psoriatic disease pathogenesis (3), the skin tissues from IMQ-treated p38αΔDC mice had lower expression of various related cytokine and chemokine mRNAs, such as Il17a, Tnfa, Il6, Il1b, Il23a, Csf2, and Cxcl1 (Fig. 2A). However, expression of Ifng, Il12a, Il4, Il10, Tgfb1, and Foxp3 was similar to that in WT mice (Fig. 2A). Although IL-22 plays an essential role in inflammatory skin disorders, including psoriasis (3134), the expression of Il22 mRNA was comparable between WT and p38αΔDC mice (Fig. 2A). Moreover, certain genes encoding antimicrobial peptides such as S100a7a and S100a8, and genes responsible for KC proliferation including Krt16 and Krt17, were also significantly decreased in p38αΔDC mice (Fig. 2A and fig. S4A). Consistent with the mRNA expression data, enzyme-linked immunosorbent assay (ELISA) showed that IL-17, TNFα, IL-1β, and IL-6 production was lower in skin tissue from IMQ-treated p38αΔDC mice (fig. S4B). We found by flow cytometry that CD45+ cells, especially γδ T cells, were a major source of IL-17 both in the epidermis and dermis (fig. S5, A and B), as previously demonstrated (5). The expansion of IL-17–producing γδ T cells was greater than that of αβ T cells in both the epidermis and dermis of WT mice (fig. S5, C and D), and the extent of this expansion was decreased in p38αΔDC mice (Fig. 2, B to E). The decreased IL-17 production from CD4+ and γδ T cells was also observed in the DLNs of p38αΔDC mice, whereas the frequencies of IFNγ+ and Foxp3+ CD4+ T cells were similar in the two groups of mice (fig. S5, E and F). WT and p38αΔDC mice had comparable Ki-67 and active caspase-3 staining in both γδ T cells and CD4+ T cells upon IMQ treatment (fig. S6, A and B), indicating that p38α deficiency in DCs did not affect T cell proliferation and survival. These results demonstrate that p38α signaling in DCs is specifically important for the generation of IL-17–producing T cells in mouse skin upon IMQ treatment.

Fig. 2 p38α activity in DCs is required for the generation of IL-17–producing T cell in vivo.

WT and p38αΔDC mice were topically treated with IMQ for six consecutive days. (A) Relative mRNA expression of inflammation-related genes in skin tissue was examined (n = 5 mice per group). ns, not significant. (B and C) The percentages (B) and cell numbers (C) of interleukin-17–positive (IL-17+) γδ T cells in the epidermis and dermis (n = 6 mice per group). γδTCR, γδ T cell receptor. (D and E) The percentages (D) and cell numbers (E) of IL-17+ CD4+ T cells in the epidermis and dermis (n = 6 mice per group). Two-sided Student’s t tests were performed, and data are means ± SEM. Data are representative of three independent experiments.

p38α activity in LCs is important for the generation of IL-17–producing T cells and the pathogenesis of psoriasis

We next sought to identify the DC subsets in mouse skin in which p38α signaling is important for psoriasiform skin inflammation. For this, we transplanted bone marrow (BM) cells of WT or p38αΔDC mice into x-ray–irradiated WT or p38αΔDC mice to generate WT→WT, WT→p38αΔDC, p38αΔDC→WT, and p38αΔDC→p38αΔDC chimeras. Two months after transplantation, chimeras were treated with IMQ to induce psoriasiform skin disease. Compared with IMQ-treated WT→WT chimeras, WT→p38αΔDC chimeras showed decreased ear thickness and composite psoriasis scores (Fig. 3A and fig. S7A). Histological analysis showed that the skin of WT→p38αΔDC chimeras had substantially less epidermal hyperplasia and inflammation (Fig. 3B). Flow cytometry analysis showed that WT→p38αΔDC chimeras had diminished infiltration of neutrophils into the epidermis and dermis (Fig. 3C and fig. S7B). Intracellular staining also showed lower IL-17 production from γδ and CD4+ T cells in the DLNs of WT→p38αΔDC chimeras than did those from WT→WT chimeras (Fig. 3D and fig. S7C). Moreover, skin samples from WT→p38αΔDC chimeras exhibited lower expression of Il17a, Tnfa, Il6, Il1b, and Cxcl1 mRNA expression than WT→WT chimeras (Fig. 3E). Because LCs are resistant to x-ray irradiation (35) and both WT→WT and WT→p38αΔDC chimeras contained the same dDC and circulating DC subsets but different LCs, these results indicate that p38α signaling in LCs is important for IMQ-induced psoriasiform skin inflammation.

Fig. 3 p38α signaling in LCs is important for the development of IMQ-induced skin inflammation.

Bone marrow (BM) cells of WT or p38αΔDC mice were transplanted into x-ray–irradiated WT or p38αΔDC mice, respectively, to make the WT→WT, WT→p38αΔDC, p38αΔDC→WT, and p38αΔDC→p38αΔDC chimeras. The chimeras were topically treated with IMQ for six consecutive days. (A) Change in ear thickness (n = 6 mice per group). (B) Representative images of H&E staining of skin section (n = 3 mice per group). Scale bars, 200 μm. (C) The percentages of neutrophils in the epidermis and dermis (n = 6 mice per group). (D) The percentages of IL-17+ γδ T cells and IL-17+ CD4+ T cells in the draining lymph nodes (DLNs) (n = 6 mice per group). (E) The relative expression of inflammation-related genes in skin tissue (n = 6 mice per group). Two-way ANOVA with Bonferroni post tests (A) and one-way ANOVA with Bonferroni post tests (C to E) were performed, and data are means ± SEM. Data are representative of two independent experiments.

When transplanting WT or p38αΔDC BM cells into x-ray–irradiated WT mice, we found that both IMQ-treated WT→WT and p38αΔDC→WT chimeras had comparable ear thickness and composite psoriasis score (Fig. 3A and fig. S7A), histological changes (Fig. 3B), as well as similar infiltration of neutrophils into the epidermis and dermis (Fig. 3C and fig. S7B). The IL-17 production from γδ and CD4+ T cells in the DLNs was comparable (Fig. 3D and fig. S7C). Moreover, mRNA expression of Il17a, Tnfa, Il6, Il1b, and Cxcl1 was comparable between WT→WT and p38αΔDC→WT chimeras (Fig. 3E). In addition, we found that WT→p38αΔDC and p38αΔDC→ p38αΔDC chimeras had comparable skin inflammation and cytokine production upon IMQ treatment (Fig. 3, A to E, and fig. S7, A to C). Thus, our results clearly show that p38α activity in host radioresistant LCs, but not in dDCs, is important for the generation of IL-17–producing T cells and the pathogenesis of psoriasis.

Signaling through p38α in LCs promotes IL-17–producing T cell generation and psoriasis pathogenesis by regulating the expression of IL-23 and IL-6

To assess whether p38α signaling in LCs stimulates T cells to produce IL-17, we cultured LCs from WT and p38αΔDC mice with γδ T cells in the presence of R848 for 48 hours. γδ T cells cocultured with p38αΔDC LCs produced significantly less IL-17 than did those cocultured with WT LCs (Fig. 4A). To determine whether p38α mediates LC–T cell cross-talk by driving the lineage differentiation of antigen-specific naïve precursors, we cultured naïve CD4+ transgenic T cells specific for ovalbumin (OT-II) together with LCs isolated from WT and p38αΔDC mice in the presence of cognate antigen and R848 for 5 days. Fewer T cells cocultured with p38αΔDC LCs developed into IL-17+ cells than did those cocultured with WT LCs (Fig. 4B). This effect was associated with lower Il17a mRNA expression in T cells activated by R848-pulsed p38αΔDC LCs, but comparable mRNA expression of Ifng, Il4, and Foxp3 (fig. S8A). These results indicate that p38α in LCs stimulates IL-17 production in T cells in vitro.

Fig. 4 Signaling by p38α in LCs controls IL-17–producing T cell generation and skin inflammation by regulating the expression of IL-6 and IL-23.

(A) IL-17 production in the supernatant of γδ T cells cocultured with R848-stimulated WT and p38αΔDC Langerhans cells (LCs) for 48 hours (n = 3 biological replicates). (B) The differentiation of TH17 cells in CD4+ T cells activated with R848-pulsed WT and p38αΔDC LCs for 5 days (n = 3 biological replicates). (C and D) Cytokine expression from WT and p38αΔDC LCs stimulated with R848 for 5 (C) and 24 hours (D) (n = 3 biological replicates). (E) IL-17 production from γδ T cells cocultured with WT and p38αΔDC LCs in the presence or absence of IL-23, IL-1β, or IL-6 (n = 3 biological replicates). (F) Relative mRNA expression of Il17 in CD4+ T cells cocultured with WT and p38αΔDC LCs in the presence or absence of IL-23, IL-1β, or IL-6 (n = 3 biological replicates). (G) Change in ear thickness of IMQ-treated WT and p38αΔDC mice subcutaneously injected with IL-23 or control phosphate-buffered saline (PBS) (n = 5 to 6 mice per group). (H) Change in ear thickness of IMQ-treated WT and p38αΔDC mice subcutaneously injected with IL-6 or control PBS (n = 5 to 8 mice per group). (I and J) Inflammation-related gene expression of IMQ-treated WT and p38αΔDC mice subcutaneously injected with IL-23 (I) or IL-6 (J) (n = 5 mice per group). Two-sided Student’s t tests (A to D and I and J) and two-way ANOVA with Bonferroni post tests (E to H) were performed, and data are means ± SEM. Data are representative of five (A and B), three (C and D and G to J), or four (E and F) independent experiments. Cells used in (A) to (F) were isolated from four to six mice per group.

Next, we explored the molecular mechanisms by which p38α acted in LCs to promote IL-17–producing T cell development. WT and p38αΔDC mice expressed comparable costimulatory molecules, such as CD40, CD80, and CD86 in LCs upon IMQ treatment (fig. S8B). To determine whether p38α signaling in LCs regulates the expression of cytokines that biases IL-17–producing T cell development, we stimulated LCs from WT and p38αΔDC mice with R848 for either 5 or 24 hours. Among the cytokines that potentiate IL-17–producing T cell differentiation, the expression of IL-6, IL-1β, and IL-23 in LCs was lower in p38αΔDC mice than that in WT mice at both mRNA and protein levels (Fig. 4, C and D, and fig. S8C), but the mRNA levels of Il12a, Il27, and Tgfb1 and the protein level of TNFα were comparable in LCs from WT and p38αΔDC mice (Fig. 4, C and D).

To identify the cytokine lost in p38αΔDC LCs that was responsible for reduced T cell IL-17 production, we added back recombinant IL-23, IL-1β, or IL-6 to LC–γδ T cell cocultures. The addition of IL-23 to p38αΔDC LC–γδ T cell cocultures completely restored the defective IL-17 production from γδ T cells, whereas the addition of IL-1β or IL-6 partially or did not restore the defective IL-17 production (Fig. 4E). In LC–CD4+ T cell cocultures, we found that addition of IL-23 or IL-6, but not IL-1β, partially restored Il17 expression in CD4+ T cells activated by p38αΔDC LCs (Fig. 4F). Collectively, these data showed that p38α signaling orchestrated a program for LC-dependent IL-17–producing T cell differentiation.

We sought to further assess the functional importance of p38α-dependent cytokine production in WT and p38αΔDC mice treated with IMQ to induce psoriasiform inflammation. Intradermal injection of IL-23 and IL-6, but not IL-1β, aggravated the severity of IMQ-induced psoriasiform disease (Fig. 4, G and H, and fig. S9A). Injection of either IL-23 or IL-6, but not IL-1β, restored ear swelling in p38αΔDC mice (Fig. 4, G and H, and fig. S9A). In addition, IL-23 injection completely restored expression of Il17a, Tnfa, Il6, Il1b, Il23a, and Cxcl1 in IMQ-treated p38αΔDC mice. In contrast, IL-6 and IL-1β restored expression of some cytokines (Fig. 4, I and J, and fig. S9B). Together, these results showed that p38α mediated the effect on IL-17–producing T cell development and psoriasis pathogenesis through distinct cytokines.

We explored the role of p38α signaling in different DC subsets on cytokine production and IL-17–producing T cell development with R848-stimulated dDCs from WT and p38αΔDC mice. We found that compared with WT dDCs, p38αΔDC dDCs secreted less IL-6 but comparable IL-23 and IL-1β (fig. S10A). Next, we cocultured WT and p38αΔDC dDCs with γδ T or naïve CD4+ T cells and found that CD4+ T cells activated by p38αΔDC dDCs secreted less IL-17, whereas γδ T cells activated by both WT and p38αΔDC dDCs expressed comparable levels of IL-17 (fig. S10, B and C). Because γδ T cells are the major IL-17–producing cells that are critical in IMQ-induced psoriasis (5), p38α signaling in different DC subsets instructs IL-17–producing T cell generation and promotes psoriasis pathogenesis through the regulation of IL-23 expression.

IMQ-induced psoriasiform skin disease does not require p38α in T cells

Although p38α signaling in T cells is not required for TH17 cell differentiation (30), T cell–intrinsic p38α could potentially influence psoriasis pathogenesis by other mechanisms. To evaluate the potential role for T cell–dependent p38α activation in psoriasis, we generated Mapk14fl/flCD4-Cre mice (referred to as “p38αΔT mice” here (30)), which efficiently ablates p38α from T cells (fig. S11A). T cell–specific deletion of p38α did not influence the severity or onset of psoriasis as indicated by comparable disease scores, pathological changes, and immune cell recruitment between IMQ-treated WT and p38αΔT mice (Fig. 5, A to F). Moreover, genetic abrogation of p38α in T cells did not appreciably affect IL-17 production by γδ T cells or the expression of Il17a, Tnfa, Il6, Il1b, Il23a, and Cxcl1 in the skin (fig. S11, B and C). Thus, our results demonstrate that p38α signaling in T cells does not affect IL-17–producing T cell generation or psoriasis development.

Fig. 5 p38α MAPK in T cells is dispensable for the induction of psoriasiform inflammation.

WT and p38αΔT mice were topically treated with IMQ cream for six consecutive days. (A) Change in ear thickness (left) and disease severity score (right) (n = 5 to 6 mice per group). (B) Representative images of H&E staining in skin section (n = 3 mice per group). Scale bars, 200 μm. (C and D) The percentages (C) and cell numbers (D) of neutrophils and macrophages in the epidermis (n = 5 to 6 mice per group). (E and F) The percentages (E) and cell numbers (F) of neutrophils and macrophages in the dermis (n = 5 to 6 mice per group). Two-way ANOVA (left panel of (A)) and two-sided Student’s t tests (right panel of (A); (C) to (F)) were performed, and data are means ± SEM. Data are representative of three independent experiments.

Inhibition of p38 ameliorates psoriasiform skin disease

To evaluate p38α as a potential therapeutic target for the treatment of psoriasis, we examined whether inhibition of p38 activity can alleviate psoriasiform inflammation. When the p38 inhibitor SB203580 was injected into mice that had been previously treated with IMQ, we found that these mice had markedly diminished ear swelling and lower psoriasis disease scores than vehicle-treated mice (Fig. 6A). Histological analysis showed that the skin of SB203580-treated mice had substantially less epidermal hyperplasia and inflammation than vehicle-treated mice (Fig. 6B). The infiltration of neutrophils and macrophages into the epidermis and dermis was also reduced in SB203580-treated mice (Fig. 6, C to F). Moreover, the skin tissues from SB203580-treated mice had lower expression of Il17a, Tnfa, Il6, Il1b, Il23a, and Cxcl1 compared with vehicle-treated mice (Fig. 6G). However, the expression of Il10 and Tgfb1 in skin tissue was not affected by SB203580 treatment (Fig. 6G). IL-17 production by CD4+ and γδ T cells was also decreased in the DLNs of SB203580-treated mice, whereas the frequencies of IFNγ+ and Foxp3+ CD4+ T cells were similar between the two groups (fig. S12, A and B). Because a secondary approach to evaluate whether ablation of p38 signaling can ameliorate established psoriatic disease, we administered tamoxifen to WT and p38αCreER mice to acutely ablate p38α expression on days 5 to 8 post-IMQ exposure. Consistent with our SB2034580 treatment results, we observed substantial reductions in ear swelling, composite psoriasis score, neutrophil infiltration, the production of IL-17 from CD4+ and γδ T cells, and the frequency of IFNγ+ CD4+ T cells in the DLNs in tamoxifen-treated p38αCreER mice (fig. S13, A to C). The frequency of Foxp3+ CD4+ T cells was similar in the DLNs from tamoxifen-treated WT and p38αCreER mice (fig. S13C). These results collectively suggest that inhibition of p38 could offer an approach to treat psoriasis and other inflammatory skin diseases.

Fig. 6 Inhibition of p38 activity reduces disease severity in mice with established skin inflammation.

WT mice were topically treated with IMQ for six consecutive days and received either the p38 inhibitor SB203580 or control vehicle daily by intraperitoneal injection from day 3. (A) Change in ear thickness (left) and disease severity score (right) (n = 6 mice per group). (B) Representative images of H&E staining in skin section (n = 3 mice per group). Scale bars, 200 μm. (C and D) The percentages (C) and cell numbers (D) of neutrophils and macrophages in the epidermis (n = 6 mice per group). (E and F) The percentages (E) and cell numbers (F) of neutrophils and macrophages in the dermis (n = 6 mice per group). (G) Relative expression of inflammation-related genes in skin tissue (n = 6 mice per group). Two-way ANOVA (left panel of (A)) and two-sided Student’s t tests (right panel of (A); (C) to (G)) were performed, and data are means ± SEM. Data are representative of three independent experiments.

DISCUSSION

Although mounting evidence demonstrates essential roles for IL-17–producing T cell–mediated inflammation and DC–T cell cross-talk in the pathogenesis of psoriasis, DC-specific signaling pathways that regulate IL-17–producing T cell responses in the skin still remain poorly defined. Here, we report that p38α signaling in LCs, but not in other DC subsets or T cells, centrally regulated IL-17 production by CD4+ and γδ T cells in IMQ-induced psoriasis model, whereas leaving IFNγ-, IL-4–, and Foxp3-expressing T cell generation unaffected. p38α activity in LCs differentially promoted IL-17 production from γδ and CD4+ T cells by secreting IL-23 and IL-6, respectively. Our findings highlight a crucial role for an axis involving p38α, IL-23, IL-6, and IL-17–producing T cells in psoriasis and suggest that targeting p38α signaling in LCs may provide an attractive treatment for inflammatory skin disease.

The success of IL-17 blockade in the treatment of psoriasis patients underscores the central role of this cytokine in the pathophysiology of psoriasis (9). IL-17 can be secreted by multiple cell types, including CD4+ (TH17), CD8+ (Tc17), γδ+ T cells, innate lymphocytes, and neutrophils (36). The cytokines IL-1β, IL-6, IL-23, and TGFβ (transforming growth factor–β) contribute to the differentiation of TH17 cells (3739), but the importance of these individual cytokines in directing TH17 cell development in vivo still remains controversial and may vary depending on the disease models, environmental factors, or target organs (4042). Our previous work establishes that p38α signaling in splenic DCs stimulates TH17 cell differentiation through the production of IL-6, IL-27, and CD86 expression but is dispensable for IL-1β and IL-23 production (30). In contrast, we showed in the current study that p38α signaling in LCs regulated TH17 cell differentiation independently of Il27 and CD86 expression (Fig. 4C and fig. S8B). Furthermore, we discovered that IL-23 production downstream of p38α signaling contributed to LC-mediated regulation of IL-17 production by γδ T cells. However, p38α was not required for IL-1β and IL-23 production by skin dDCs, which was similar with our previous findings in splenic DCs (30). Thus, the discrepant regulation of specific cytokines by the same intracellular signaling pathway in splenic DCs or dDCs compared to skin LCs further highlights the functional heterogeneity of DCs. Further identification of the molecular pathways that underpin the cell-specific regulation inflammatory responses by p38α is needed to unlock the full clinical potential of DC-targeted therapeutics.

DCs bridge innate and adaptive immunity by capturing antigens and migrating into lymph nodes to initiate protective immune responses (12). Although DC numbers are increased in psoriasis lesions, the results from different groups on the roles of DCs in psoriasis pathogenesis are still controversial because of the usages of different triggers, genetic models, and experimental time points (13, 19, 20, 22, 4348). Our BM chimera results demonstrated that p38α signaling in LCs, but not in other dDCs or inflammatory DCs, was crucial for IL-17–producing T cell development and disease pathogenesis. These results provided genetic evidence supporting the idea of a key proinflammatory function of LCs in psoriasis and that p38α signaling could differentially regulate these effects in distinct cell types.

Because p38 plays an important role in the regulation of numerous proinflammatory responses and disease models (26, 49), p38α has been extensively investigated for the treatment of inflammatory diseases. Although the advance of p38 inhibitors into clinical trials has been halted, further research into the relevant disease mechanisms could improve the clinical development of p38 inhibitors (50). Our results showing that inhibition of p38α activity after the onset of disease reduced psoriasis disease progression suggest that p38 inhibitors could be effective for IL-17–mediated diseases. Moreover, our results imply that selectively targeting p38α inhibitors to LCs ameliorated psoriasis symptoms, suggesting that new drug-delivery vehicles that target p38α inhibitors to specific tissues or cell types could be a promising strategy for avoiding undesirable side effects (51). Local delivery of a p38 inhibitor to the lung reduces inflammation and decreases adverse effects by minimizing exposure of the nontarget organs to the drug (52). Given that current cytokine antagonist biologic treatments are expensive and have considerable adverse side effects (10), targeted delivery of small-molecule p38 inhibitors might provide a potential opportunity to improve psoriasis treatment. Therefore, understanding p38α-dependent regulation of DC functions and subsequent T cell responses might be further exploited for innovative immune therapies.

MATERIALS AND METHODS

Animals

p38αflox and CD11c Cre mice have been described previously (30, 53, 54). Rosa26-Cre-ERT2 and CD45.1+ mice were provided by B. Su (Shanghai Jiao Tong University School of Medicine, China). CD4-Cre mice were provided by H. Wang (Shanghai Jiao Tong University School of Medicine, China). OT-II mice were purchased from The Jackson Laboratory. C57BL/6 mice were purchased from Shanghai SLAC Laboratory Animal Co., Ltd (Shanghai, China). All mice were backcrossed to C57BL/6 background for at least eight generations. Age- and sex-matched mice at 6 to 10 weeks of age were used for all experiments. WT or Cre+ littermate control mice were used where relevant. No adverse effects due to Cre expression itself were observed in vitro and in vivo in these studies. All mice were kept in specific pathogen–free conditions in the Animal Resource Center at Shanghai Jiao Tong University School of Medicine. Animal protocols were approved by Institutional Animal Care and Use Committee of Shanghai Jiao Tong University School of Medicine.

BM chimeras

For BM chimeric experiments, BM cells from WT or p38αΔDC mice were intravenously transferred into lethally irradiated either WT or p38αΔDC mice (5 × 106 BM cells per recipient), respectively. Recipient mice were treated with oral antibiotics for 2 weeks after transplantation.

In vivo tamoxifen treatment

WT and p38αCreER mice were intraperitoneally injected with 2 mg of tamoxifen (Sigma-Aldrich) per mouse for three consecutive days and then rested for 7 days before experiments.

IMQ-induced mouse psoriasiform skin disease model

A cream containing 5% IMQ (3M Pharmaceuticals or MedShine) providing a dose of 25 mg, or control Vaseline (Fagron), was topically applied to the ear of each mouse daily for six consecutive days. Ear thickness was measured daily using a micrometer, and skin inflammation was scored on day 6 on the basis of the extent and severity of erythema, scaling, and thickening according to the clinical psoriasis area and severity index as previously described (18). Briefly, the score was determined as follows: 0 = none, 1 = slight, 2 = moderate, 3 = marked, and 4 = very marked. Erythema, scaling, and thickening were scored independently, and the cumulative score served as the disease severity score (scale, 0 to 12). In some experiments, IMQ-treated mice were intradermally injected with recombinant IL-23 (R&D Systems), IL-6 (BD Biosciences), or IL-1β (R&D Systems) at a dose of 50 ng in 20 μl of phosphate-buffered saline (PBS) per ear on days 0, 2, and 4. Control mice were injected with the same volume of PBS with 0.1% bovine serum albumin (w/v) on the same schedule.

Pharmacological inhibition of p38

IMQ-treated WT mice were intraperitoneally administrated with p38 inhibitor SB203580 (Merck Calbiochem) at a dose of 0.75 mg/kg body weight from days 3 to 5. Liquid SB203580 dissolved in dimethyl sulfoxide (DMSO; MP Biomedicals) was diluted with PBS for injection into mice. The same volume of DMSO was diluted with PBS for injection into control mice.

Skin cell preparation

Mouse ear skin samples were collected and split into dorsal and ventral halves, and then the subcutaneous fat tissue was carefully scraped off and ears were floated split side down for 40 min at 37°C on the surface of 0.5% trypsin (w/v) (Gibco). The dermis was separated from the epidermis. Each sheet was cut into small pieces and placed into digestion solution containing collagenase IV (1.5 mg/ml (for dermis) or 1 mg/ml (for epidermis); Gibco). Digestion was performed for 90 min (for dermis) or 80 min (for epidermis) at 37°C with brief mixing. After the digestion, the solution was mixed thoroughly and filtered through a nylon filter to obtain single-cell suspension.

Cell purification, cultures, and DC cytokine assays

Epidermal LCs, γδ T cells, and naïve CD4+ T cells were enriched with microbeads (Miltenyi Biotec) and sorted with a BD FACSAria III sorter. For LC–γδ T cell coculture, LCs from naïve WT and p38αΔDC mice and γδ T cells from WT mice were mixed in the presence of R848 (1 μg/ml) (InvivoGen). After 48 hours, culture supernatants were collected for ELISA measurements. For LC–CD4+ T cell coculture, LCs from either naïve or IMQ-treated WT and p38αΔDC mice and naïve CD4+ T cells from OT-II mice were mixed in the presence of ovalbumin peptide (10 μg/ml) (OVA323–339) and R848 (1 μg/ml). After 5 days, live T cells were harvested and stimulated with PMA (phorbol 12-myristate 13-acetate; Sigma-Aldrich) and ionomycin (Sigma-Aldrich) in the presence of protein transport inhibitor (BD Biosciences) for 5 hours for intracellular cytokine staining, or with plated-bound α-CD3 (2C11; Bio X Cell) for 5 hours to measure mRNA expression. In some experiments, recombinant IL-23 (20 ng/ml) (R&D Systems), IL-1β (R&D Systems), or IL-6 (BD Biosciences) cytokines were added to the coculture systems. For DC cytokine assays, LCs from naïve or IMQ-treated WT and p38αΔDC mice were stimulated with R848 (1 μg/ml) either for 5 hours before RNA analysis or for 24 hours before ELISA measurement.

Flow cytometry

For analysis of surface markers, cells were stained in PBS containing 2% (v/v) fetal bovine serum with anti-CD45 (30-F11), anti-CD11b (M1/70), anti–Gr-1 (RB6-8C5), anti-F4/80 (BM8), anti-CD11c (N418), anti–MHC-II (M5/114.15.2), anti-EpCAM (G8.8), anti-γδTCR (eBioGL3), anti-CD3 (17A2), anti-CD4 (RM4-5), anti-CD8α (53-6.7), anti-TCRβ (H57-597), anti-CD40 (1C10), anti-CD80 (16-10A1), anti-CD86 (GL1), and 7-AAD (all from eBioscience). For intracellular staining with anti–IL-17 (eBio17B7), anti-IFNγ (XMG 1.2e), anti–IL-23 (fc23cpg), anti–IL-1β (NJTEN3), and anti–IL-6 (MP5-20F3) (all from eBioscience), cells were stimulated with PMA and ionomycin or R848 in the presence of protein transport inhibitor for 5 hours before being stained according to the manufacturer’s instructions (BD Biosciences). For intracellular phosphorylation assays, cells were stained with anti–phospho-p38 (28B10, Cell Signaling Technology) according to the manufacturer’s instructions (BD Biosciences). Staining with anti-Foxp3 (FJK-16S, eBioscience) and anti–Ki-67 (SolA15, eBioscience) were done according to the manufacturer’s instructions (eBioscience). For cell apoptosis analysis, cells were stained with Active Caspase-3 Apoptosis Kit (BD Biosciences). Flow cytometry data were acquired on BD FACSCanto II or BD LSRFortessa X-20 and were analyzed with FlowJo software (Tree Star).

Histopathological analysis

Formalin-preserved mouse ear sections were embedded in paraffin according to standard techniques. Longitudinal sections (6 μm thick) were stained with hematoxylin and eosin and analyzed by microscopic examination.

Protein and RNA analyses

For cytokine detection in skin tissue, 45-mg skin tissue was weighted and homogenized in 0.5-ml ice-cold CelLytic MT Cell Lysis reagent (Sigma-Aldrich). Concentrations of IL-17, TNFα, IL-23, IL-6, and IL-1β in homogenized or culture supernatants were measured by ELISA according to the manufacturer’s instructions (eBioscience). Total RNA of skin tissue and cells was isolated using the TRIzol reagent (Invitrogen) and RNeasy Mini Kit (Qiagen), respectively. Reverse transcription was performed via PrimeScript RT Master Mix (Takara) according to the manufacturer’s instructions. Quantitative polymerase chain reaction (PCR) was carried out with SYBR Green PCR Master Mix (Applied Biosystems) in a Vii7 Real-Time PCR system (Applied Biosystems). Relative mRNA levels were determined with hypoxanthine-guanine phosphoribosyltransferase (HPRT) as a reference gene. The following primers sequences were used: Hprt, TCAGTCAACGGGGGACATAAA (forward) and GGGGCTGTACTGCTTAACCAG (reverse); Il17a, TCAGCGTGTCCAAACACTGAG (forward) and CGCCAAGGGAGTTAAAGACTT (reverse); Tnfa, CAGGCGGTGCCTATGTCTC (forward) and CGATCACCCCGAAGTTCAGTAG (reverse); Il6, CTGCAAGAGACTTCCATCCAG (forward) and AGTGGTAT AGACAGGTATGTTGG (reverse); Il1b, GCAACTGTTCCTGAACTCAACT (forward) and ATCTTTTGGGGTCCGTCAACT (reverse); Il23a, GCCCCGTATCCAGTGTGA (forward) and GCTGCCACTGCTGACTAG (reverse); Csf2, GGCCTTGGAAGCATGTAGAGG (forward) and GGAGAACTCGTTAGAGACGACTT (reverse); Cxcl1, TGCACCCAAACCGAAGTCAT (forward) and TTGTCAGAAGCCAGCGTTCAC (reverse); Ifng, GCCACGGCACAGTCATTGA (forward) and TGCTGATGGCCTGATTGTCTT (reverse); Il12a, CAATCACGCTACCTCCTCTTTT (forward) and CAGCAGTGCAGGAATAATGTTTC (reverse); Il4, GGTCTCAACCCCCAGCTAGT (forward) and GCCGATGATCTCTCTCAAGTGAT (reverse); Il10, CTTACTGACTGGCATGAGGATCA (forward) and GCAGCTCTAGGAGCATGTGG (reverse); Tgfb1, CTCCCGTGGCTTCTAGTGC (forward) and GCCTTAGTTTGGACAGGATCTG; Foxp3, CACCTATGCCACCCTTATCCG (forward) and CATGCGTAAACCAATGGTAGA (reverse); Il22, ATGAGTTTTTCCTTATGGGGAC (forward) and GCTGGAAGTTTGGACACCTCAA (reverse); S100a7a, TGCTCTTGGATAGTGTGCCTC (forward) and GCTCTGTGATGTAGTATGGCTG (reverse); S100a8, TGTCCTCAGTTTGTGCAGAATATAAA (forward) and TCACCATCGCAAGGAACTCC (reverse); Krt16, GGTGGCCTCTAACAGTGATCT (forward) and TGCATACAGTATCTGCCTTTGG (reverse); Krt17, ACCATCCGCCAGTTTACCTC (forward) and CTACCCAGGCCACTAGCTGA (reverse); Il27, CTGTTGCTGCTACCCTTGCTT (forward) and CACTCCTGGCAATCGAGATTC (reverse); and Mapk14, GAGGTGCCCGAACGATAC (forward) and TGGCGTGAATGATGGACT (reverse).

Statistical analysis

The data were analyzed with GraphPad Prism 5 or SPSS 17.0 and are means ± SEM. Analysis of variance (ANOVA) with Bonferroni post test was used for multiple comparisons, and Student’s t test was used when two conditions were compared. P values were indicated, and P < 0.05 was considered significant. Two-sided Student’s t tests and one-way or two-way ANOVA was performed. ns indicates no significance. Error bars represent SEM.

SUPPLEMENTARY MATERIALS

www.sciencesignaling.org/cgi/content/full/11/521/eaao1685/DC1

Fig. S1. p38α deletion in mouse skin tissue and DCs.

Fig. S2. Normal DC development and activation status in the epidermis and dermis of p38αΔDC mice.

Fig. S3. Cell infiltration analysis in the skin and spleen of WT and p38αΔDC mice upon IMQ treatment.

Fig. S4. Gene expression in KCs and cytokine production in skin tissue of WT and p38αΔDC mice upon IMQ treatment.

Fig. S5. Decreased IL-17 production from γδ and CD4+ T cells in the skin and DLNs of p38αΔDC mice.

Fig. S6. The proliferation and apoptosis of T cells in IMQ-treated WT and p38αΔDC mice.

Fig. S7. p38α activity in LCs is important for psoriasiform skin inflammation.

Fig. S8. LC p38α-mediated TH17 cell differentiation and IL-23, IL-1β, and IL-6 expression.

Fig. S9. The effect of p38α signaling in DCs on skin inflammation is IL-1β–independent.

Fig. S10. p38α in dDCs affects IL-17 production from CD4+ T cells but not γδ T cells.

Fig. S11. p38α activity in T cells does not contribute to the IMQ-induced psoriasiform skin inflammation.

Fig. S12. Decreased IL-17 production from γδ and CD4+ T cells in the DLNs upon SB203580 treatment.

Fig. S13. Acute deletion of p38α reduces the severity of an ongoing psoriasiform skin inflammation.

Acknowledgments: We thank J. R. Lukens (University of Virginia, USA) for critical reading and editing of the manuscript and B. Su (Shanghai Jiao Tong University School of Medicine, China) for providing the insightful suggestion. We also thank B. Wang (Shanghai Jiao Tong University School of Medicine, China) for confirming the appropriate statistical tests used in our study. Funding: This work was supported by the National Natural Science Foundation of China (31670897, 81471528, and 91642104 to G.H. and 81671399 to X.L.), the Ministry of Science and Technology of China (973 Basic Science Project 2014CB541803 to G.H.), the Program for Professor of Special Appointment (Eastern Scholar) at Shanghai Institutions of Higher Learning (to G.H.), the Shanghai Municipal Commission of Health and Family Planning (20154Y0120 to R.H. and 20164Y0127 to T.Z.), and the Shanghai Sailing Program (17YF1416600 to T.Z.). Author contributions: T.Z., W.Z., and H. Li designed and performed the in vivo and cellular experiments and contributed to manuscript writing. S.X. and M.H. contributed to gene expression analyses and molecular experiments. H. Liu contributed to chimera experiments. R.H. contributed to animal colony management. Y.L. contributed to histopathology analysis. K.O. contributed mouse models. X.L. provided reagents and contributed to chimera experiments. G.H. designed experiments, analyzed the data, wrote the manuscript, and provided overall direction. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper or the Supplementary Materials.

Psorilax:Rimedio |crema nivea e psoriasi

0

Psorilax: prezzo, funziona, recensioni, opinioni, originale

Con il riscaldamento centralizzato alla massima potenza, togliendo l'umidità dalla pelle, quei cerotti asciutti che hai sviluppato potrebbero aver bisogno di più di una piccola quantità di crema idratante.

Secondo il dott. Ross Perry, direttore medico delle Cosmedics Skin Clinics, una visita su 10 al medico di famiglia è legata alla pelle, e quel numero aumenta mentre lo stile di vita delle persone diventa più stressante.

Qui rivela le 10 condizioni più comuni della pelle e spiega come risolverle.



Una visita su 10 al GP è ora legata alla pelle

1. Sintomi: Macchie di pelle secche, rosse e pruriginose, generalmente osservate dietro le ginocchia e nelle pieghe dei gomiti

Diagnosi: Eczema

Causa: Questo può iniziare a qualsiasi età – durante l'infanzia o l'età adulta. Può funzionare in famiglie o verificarsi in modo casuale ed è collegato con asma e raffreddore da fieno. I fattori scatenanti includono malessere, stress ed esposizione agli allergeni.

Soluzione: Usa creme steroidi idratanti e idrocortisone per controllarlo. “Per fortuna molti bambini crescono a causa dell'eczema, ma per gli adulti può essere un problema permanente che richiede una gestione regolare”, afferma il dott. Perry.

2. Sintomi: Placche secche e squamose di pelle che non sono pruriginose e normalmente si trovano sulla parte anteriore delle ginocchia o all'esterno dei gomiti

Diagnosi: Psoriasi



Idratanti e creme di vitamina D possono aiutare chi soffre di psoriasi

Causa: Si verifica in genere nei giovani adulti dopo un recente mal di gola, ma può anche funzionare in famiglie. Può essere collegato con i sintomi dell'artrite.

Soluzione: Creme idratanti, steroidi e vitamina D. Se grave, il trattamento della luce UVB può aiutare. “La prognosi tende a durare tutta la vita e andrà e verrà con riacutizzazioni quando sei stressato o malato”, afferma il dott. Perry.

3. Sintomi: Macchie pallide di pelle che possono verificarsi su qualsiasi parte del viso o del corpo

Diagnosi: Vitiligine

Causa: Sebbene la causa esatta non sia nota, si ritiene che la vitiligine sia una malattia autoimmune in cui il sistema immunitario del corpo distrugge le cellule che formano i pigmenti note come melanociti.

Soluzione: “Le creme steroidee possono aumentare la produzione di melanina nelle zone più leggere della pelle e i trattamenti leggeri in ospedale possono avere un effetto positivo”, afferma il dott. Perry. “Purtroppo, spesso non si può fare altro che applicare la crema solare sulla pelle circostante per uniformare il colore”.

4. Sintomi: Area verde / gialla scabby rossa, leggermente gonfia che si diffonde rapidamente per alcuni giorni.

Diagnosi: Impetigine

Causa: Questa è un'infezione batterica della pelle altamente contagiosa che si trova più comunemente sul viso, ma può anche apparire su qualsiasi parte della pelle.

Soluzione: “L'impetigine si verifica più comunemente nei bambini piccoli e in età scolare e la condizione può essere molto angosciante perché è così contagiosa e visibile”, afferma il dott. Perry.

“Ma un ciclo di antibiotici orali di solito lo risolve completamente in sette a 10 giorni.”

5. Sintomi: Molteplici macchie rosse gonfie su viso, collo, schiena e petto, spesso con una piccola area di pus alla testa di loro

Diagnosi: Acne

Causa: Legato a un batterio sulla pelle, spesso corre nelle famiglie.

Soluzione: Lavaggi o creme antibatterici, bucce della pelle che creano un ambiente ostile ai batteri, antibiotici orali e trattamenti laser più recenti che possono uccidere i batteri o ridurre il rossore. “Un trattamento efficace e precoce è importante in quanto l'acne può lasciare cicatrici”, afferma Dr Perry. “Stiamo vedendo sempre più acne per adulti adesso.”

6. Sintomi: Rossore arrossato e vasi sanguigni rotti sul viso, in genere le aree delle guance, del naso e del mento

Diagnosi: rosacea



Lo stress e l'alcool possono scatenare la rosacea

Causa: Questa è una condizione infiammatoria che alcuni credono sia causata da anomalie nei vasi sanguigni del viso. Non è contagioso ma risponde ad alcuni antibiotici. I fattori scatenanti includono il consumo di bevande alcoliche e lo stress che può infiammarlo e peggiorare l'aspetto.

Soluzione: Antibiotici per via orale. “I trattamenti con luce laser e pulsata possono essere efficaci nel ridurre il rossore”, afferma Dr Perry.

7. Sintomi: Zone rosse sul viso, sul cuoio capelluto e sul centro del torace con pelle grassa dall'aspetto scaglie spesso nell'attaccatura dei capelli, sopracciglia e lati del naso

Diagnosi: Dermatite seborroica

Causa: Una crescita eccessiva di lievito chiamata malassezia che vive sulla pelle o una reazione eccessiva del sistema immunitario della pelle a questo lievito.

Il dott. Perry spiega: “Questo di solito non è collegato a nessuna malattia di base, può divampare quando sei stanco o stressato ed è più comune nel freddo che nel caldo”.

Soluzione: Lavora dalla testa in giù – usa uno shampoo antifungino e antiforfora contenente il principio attivo nizoral e usa creme antifungine sulla pelle. Le creme steroide delicate possono essere utilizzate per brevi periodi per risolvere qualsiasi irritazione.

“La dermatite seborroica colpisce circa il 4% della popolazione e la forfora – che è una lieve dermatite seborroica del cuoio capelluto – colpisce quasi la metà di tutti gli adulti ad un certo punto della loro vita”, afferma il dott. Perry.

8. Sintomi: Noduli granulosi ruvidi con cime arrotondate ovunque dal viso alle mani

Diagnosi: verruche

Causa: Il virus del papilloma umano.

Soluzione: Rimedi da banco come acidi delicati per bruciare le verruche, nonché trattamenti medici come congelamento e laser. “I trattamenti possono richiedere più sessioni e c'è sempre il rischio che ritornino poiché il virus è presente per tutta la vita nel tuo sistema – ma raramente si mostra sotto forma di verruche”, afferma Dr Perry.

“In periodi di stress hanno maggiori probabilità di tornare e i fumatori sono inclini”.

9. Sintomi: Blister e croste, tipicamente ai bordi della bocca o delle labbra

Diagnosi: Herpes labiale

Causa: Il virus dell'herpes simplex (tipo 1).

Soluzione: Creme antivirali che devono essere applicate non appena il malato avverte un formicolio dove è stata una piaga prima, o non appena appare una nuova vescica o crosta.

“Se sono gravi o ritornano molto frequentemente, le compresse antivirali possono aiutare”, afferma il dott. Perry. “L'herpes simplex è altamente contagioso e ce l'hai per tutta la vita.”

10. Sintomi: Varie: prurito, arrossamento, gonfiore, vesciche e croste

Diagnosi: Allergia



Le reazioni a un allergene possono causare prurito e vesciche

Causa: Reazione a un allergene che può derivare dal contatto diretto o dal consumo di qualcosa.

Soluzione: Rimuovi l'allergene o assicurati di non essere in contatto con la potenziale causa. Quindi trattare i sintomi, spesso con compresse di antistaminici e / o creme steroidi.

“Queste reazioni possono accadere a chiunque e spesso senza che la persona sappia mai l'esatto allergene”, afferma il dott. Perry. “Lo scenario peggiore è quando una reazione allergica scatena sintomi come gonfiore delle labbra o causa difficoltà respiratorie, nota come anafilassi e necessita di cure mediche urgenti.”

Psorilax:Il miglior risparmio per |crema per psoriasi con cortisone leo

0

Psorilax: prezzo, funziona, recensioni, opinioni, dove si compra

Morsi delle pulci nella definizione e nei fatti umani

Immagine di Flea Bites

Immagine di Flea Bites

  • Le pulci sono un insetto parassita che si nutre del sangue di mammiferi e uccelli.
  • La specie di pulci più comune negli Stati Uniti è la pulce di gatto, Ctenocephalides felis.
  • Le “pulci di sabbia” non sono un tipo di fuga. Sono minuscoli crostacei, con un morso simile a quello della pulce di gatto.
  • I morsi delle pulci sugli esseri umani sembrano piccole macchie rosse che spesso si verificano in due o tre gruppi o grappoli con arrossamenti intorno a loro.
  • I sintomi dei morsi delle pulci sugli esseri umani includono
    • macchie rosse con un alone,
    • prurito,
    • orticaria,
    • eruzione cutanea (caratterizzata da piccoli grappoli di protuberanze) e
    • gonfiore intorno al morso.
  • Sintomi di reazioni allergiche ai morsi delle pulci che sono un'emergenza medica e includono difficoltà respiratorie (mancanza di respiro o respiro sibilante), gonfiore delle labbra o della lingua, vertigini, nausea e dolore al petto.
  • L'infezione da morsi di pulci può verificarsi a causa di graffiare i morsi.
  • Le pulci possono trasmettere una serie di malattie, inclusa la peste (Yersinia pestis), bartonellosi, tifo (Rickettsia typhi), tungiasi e tenia delle pulci.
  • Uno dei primi segni di un'infestazione da pulci in casa è quando gli animali iniziano a grattarsi, mordersi o leccarsi eccessivamente.
  • Le pulci possono anche infestare una casa senza animali domestici.
  • I morsi delle pulci possono essere trattati con creme, lozioni o unguenti anti-prurito da banco (OTC). Lavare prima l'area per evitare che l'infezione si diffonda ed evitare di graffiare il morso.
  • I rimedi casalinghi per lenire o alleviare il prurito dai morsi delle pulci includono impacchi di ghiaccio, aloe vera, amamelide, alcol denaturato, aceto, olio dell'albero del tè e bustine di tè usate.
  • Previeni i morsi delle pulci mantenendo i tuoi animali domestici e la casa liberi dalle pulci. Usa un prodotto preventivo contro le pulci sui tuoi animali domestici e mantieni la tua casa pulita e aspirali regolarmente.
  • Potrebbe essere necessario consultare uno specialista del controllo dei parassiti per sbarazzarsi delle pulci.

Puoi prendere la peste bubbonica dal tuo cane?

Le pulci apriranno rapidamente negozi su animali domestici non trattati e i piccoli bastardi possono trasferirti
e la tua famiglia. Le pulci possono anche trasmettere malattie gravi alle persone, per
esempio, la peste bubbonica. I sintomi della peste bubbonica includono:

  • Linfonodi ingrossati, dolorosi e teneri
  • Brividi
  • Febbre
  • Debolezza
  • Mal di testa

Chiedi al tuo veterinario informazioni sui farmaci contro le pulci una volta al mese e metti un mese
promemoria sul tuo calendario per evitare infezioni secondarie da morsi di pulci.

Cosa sono le pulci? Come sono fisicamente?

Le pulci sono un insetto parassita che si nutre del sangue di mammiferi e uccelli. Ci sono circa 2.500 specie di pulci nel mondo. La specie di pulci più comune negli Stati Uniti è la pulce di gatto, Ctenocephalides felis, che infesta anche i cani e può mordere gli esseri umani.

Gli esseri umani possono essere morsi dalle cosiddette “pulci di sabbia”, che di solito si trovano sulla spiaggia e nelle zone costiere. In realtà non sono insetti, ma minuscoli crostacei, sebbene il loro morso sia simile a quello della pulce di gatto. Non infestano le case.

Le pulci adulte sono lunghe da 1/12 a 1/8 di pollice, prive di ali, ovali, piatte da un lato all'altro e di colore bruno-rossastro scuro. Hanno sei gambe lunghe e possono saltare molto in alto e lontano, circa 200 volte la loro lunghezza del corpo. Le larve delle pulci sono di colore bianco pallido e misurano circa 3 mm di lunghezza, simili a minuscoli vermi.

Che aspetto ha un morso di pulce su una persona (immagini)?

I morsi delle pulci sembrano piccoli punti rossi. Questi punti si verificano spesso in due o tre gruppi o grappoli con arrossamento intorno a loro e talvolta un alone leggero. Tendono a mordere gli umani intorno ai piedi, alle caviglie e alla parte inferiore delle gambe.

Per le persone allergiche ai morsi delle pulci, possono esserci aree più grandi di arrossamento e piccole protuberanze simili a brufoli.

Il rossore può durare da poche ore a diversi giorni, a seconda della reazione di un individuo e di quanto (o poco) i morsi vengono graffiati.

Immagine dei morsi delle pulci

Immagine dei morsi delle pulci




PRESENTAZIONE

Cattivi insetti: identifica insetti e punture di insetti
Vedi Presentazione

Quali sono i segni e i sintomi dei morsi delle pulci negli esseri umani?

I sintomi dei morsi delle pulci sugli esseri umani che si verificheranno immediatamente dopo essere stati morsi includono:

  • Macchie rosse con un alone
  • Prurito
  • Orticaria
  • Eruzione cutanea (caratterizzata da piccoli grappoli di protuberanze)
  • Gonfiore intorno al morso

Alcune persone sono più sensibili ai morsi delle pulci e possono avere reazioni allergiche. I sintomi delle reazioni allergiche ai morsi delle pulci includono:

Le reazioni allergiche ai morsi delle pulci possono essere un'emergenza medica, quindi chiama il 911 o recati immediatamente al pronto soccorso di un ospedale.

Morsi di pulci negli esseri umani e morsi di cimici dei letti, hanno lo stesso aspetto?

I morsi delle pulci e delle cimici dei letti sembrano simili, ma non sono la stessa cosa.

  • I morsi delle cimici dei letti spesso sembrano punture di zanzara. Possono essere rossi, sodi e potrebbe esserci un leggero gonfiore intorno al morso. I morsi delle pulci sembrano piccoli grappoli di macchie rosse.
  • I morsi delle cimici dei letti spesso compaiono in file lineari e possono apparire ovunque sul corpo, mentre i morsi delle pulci tendono a essere localizzati in gruppi spesso sui piedi e sulle caviglie.
  • Le cimici dei letti sono notturne e amano fare la loro casa nel tuo materasso, quindi i morsi di questi insetti di solito si verificano di notte quando dormi. Le pulci sono anche notturne ma tendono ad aggrapparsi agli animali domestici e si trovano su mobili, tendaggi e moquette.
  • I morsi delle cimici dei letti possono richiedere diversi giorni per apparire e inizieranno a prudere gradualmente, mentre i morsi delle pulci iniziano a prudere immediatamente e diventano gonfi e rossi entro un'ora dopo il morso.
  • Sia i morsi delle pulci che quelli delle cimici dei letti provocano prurito e possono causare reazioni allergiche.




IMMAGINI

Punture di pulci (negli esseri umani)
Guarda un'immagine di morsi di pulci insieme ad altri morsi e infestazioni
Vedi immagini

I morsi delle pulci provocano prurito? È brutto graffiarli?

Indipendentemente da quanto prurito, cerca di non graffiare i morsi delle pulci. I morsi delle pulci possono prudere intensamente e possono causare un'infezione secondaria. I sintomi di infezione da morsi di pulci includono:

sottoscrivi alla newsletter di MedicineNet su cura e condizioni della pelle

Facendo clic su “Invia”, accetto i Termini e condizioni e l'Informativa sulla privacy di MedicineNet. Accetto inoltre di ricevere e-mail da MedicineNet e comprendo che posso disattivare gli abbonamenti a MedicineNet in qualsiasi momento.

Quali sono i rimedi casalinghi naturali e altri trattamenti utilizzati per i morsi delle pulci negli esseri umani?

I rimedi naturali e casalinghi per lenire o alleviare il prurito dai morsi delle pulci includono:

  • Avvolgere impacchi di ghiaccio (o verdure surgelate) in un asciugamano e applicarli sulla pelle per alleviare il gonfiore e per intorpidire l'area.
  • L'Aloe Vera può alleviare il rossore e il gonfiore.
  • L'amamelide può aiutare con il prurito.
  • L'alcol denaturato può essere utilizzato per asciugare i morsi.
  • L'aceto bianco (diluire 1 parte di aceto con 1 parte di acqua) può fornire un sollievo temporaneo.
  • L'olio dell'albero del tè può alleviare il prurito.
  • Raffreddare le bustine di tè usate nel congelatore e applicare sul morso per alleviare l'infiammazione.

Evita di graffiare i morsi delle pulci perché puoi creare una ferita aperta che lascerà entrare i batteri e può portare a infezioni.

Posso essere infettato dai morsi delle pulci?

L'infezione e la malattia possono derivare dai morsi delle pulci. L'infezione di solito si verifica a causa di graffiare i morsi. Batteri e altri detriti possono essere presenti sotto le unghie e se una persona graffia vigorosamente un morso delle pulci, possono far sì che l'eruzione diventi una ferita aperta per l'ingresso di batteri.

Le pulci possono anche rappresentare una minaccia per la salute pubblica perché possono trasmettere una serie di malattie sia all'uomo che agli animali. Le malattie trasmesse all'uomo dalle pulci includono:

Come puoi prevenire i morsi delle pulci sugli esseri umani?

Poiché la maggior parte dei morsi delle pulci sono dovuti alle pulci portate in casa dagli animali domestici, il modo migliore per evitare di essere morsi è evitare che le pulci si mettano sui tuoi animali domestici.

  • Tieni i tuoi animali domestici lontani dagli animali che sai di aver avuto le pulci di recente.
  • Tieni i tuoi animali domestici lontani da luoghi difficili da trattare come sotto i ponti o le tettoie.
  • Falcia spesso il prato e mantieni l'erba corta.
  • Usa un pettine per pulci per controllare la presenza di pulci nel pelo del tuo animale domestico.
  • Tenere pulita la lettiera e lavare in acqua calda.
  • Aspirare frequentemente tappeti, tappeti e mobili imbottiti, soprattutto nelle aree in cui dormono gli animali domestici e sotto i letti, i divani e dietro i mobili.
  • Spolverare i mobili e le tende e i rivestimenti puliti a secco.
  • Usa una medicina preventiva contro le pulci sul tuo animale domestico una volta al mese (ad esempio, Advantage, Advantix, Frontline, Revolution, Sentinel e altri). Parla con il tuo veterinario del prodotto giusto per il tuo cane o gatto.

Se prendi le pulci sugli animali domestici o in casa presto, è molto più facile sbarazzartene prima che si diffondano in tutta la casa.

Per evitare i morsi delle pulci di sabbia se sei in spiaggia:

  • Evita la spiaggia al mattino presto e nel tardo pomeriggio, quando le pulci di sabbia si nutrono.
  • Usa lettini o sedie piuttosto che un asciugamano o una coperta sulla sabbia.
  • Indossare scarpe e calzini chiusi quando si cammina sulla spiaggia.
  • Usa un repellente per insetti con DEET.
  • Stai lontano dalle alghe, il cibo preferito delle pulci di sabbia.

A partire dal Logo WebMD

Risorse per problemi e trattamenti della pelle
Soluzioni per la salute Dai nostri sponsor

Come posso sapere se ho le pulci in casa mia?

Uno dei primi modi in cui le persone notano di avere un'infestazione da pulci è quando i loro cani o gatti iniziano a grattarsi, mordersi o leccarsi eccessivamente. Puoi usare un pettine antipulci per controllare la pelliccia del tuo animale domestico per pulci e feci delle pulci. Le feci delle pulci sul tuo animale domestico possono sembrare insetti puntiformi o macchie di sporco o pepe.

Una volta che le pulci si sono attaccate agli animali domestici, non ci vuole molto a diffondersi in casa. Una volta che hanno infestato la casa, potresti notare le pulci che saltellano sul tappeto, sui mobili o sui tendaggi.

Se sospetti che il tuo animale domestico o la tua casa possano avere un'infestazione da pulci, puoi testare le macchie scure per vedere se si tratta di feci delle pulci. Inumidisci le sospette feci delle pulci e se diventa di colore rosso o marrone, sono feci delle pulci. (Le feci delle pulci sono costituite da sangue essiccato.) Un altro modo rapido per aiutarti a controllare un'infestazione da pulci è indossare calzini bianchi lunghi. Alle pulci piace saltare sui piedi, sulle caviglie e sulla parte inferiore delle gambe degli umani. Gli insetti sono di colore bruno-rossastro scuro e se ti saltano addosso mentre indossi calzini bianchi saranno più facili da vedere.




IMMAGINI

Eczema
Sfoglia la nostra raccolta di immagini mediche di disturbi cutanei allergici come psoriasi e dermatiti e altro ancora causato da allergie
Vedi immagini

10 rimedi naturali e soluzioni per sbarazzarsi delle pulci sugli animali domestici e nelle case?

Sbarazzarsi delle pulci è un approccio su più fronti. Ci sono alcune soluzioni naturali che possono aiutare a respingerle, tuttavia, se hai un'infestazione è probabilmente meglio consultare uno specialista di rimozione dei parassiti per liberare completamente la tua casa dalle pulci e consultare il tuo veterinario per assicurarti che i tuoi animali domestici siano liberi dalle pulci.

Una volta che ti sei sbarazzato delle pulci, puoi usare alcuni rimedi naturali per evitare che ritornino.

  1. Tratta le aree della casa con soluzioni antimicrobiche come olio dell'albero del tè, spray all'aglio o polvere di farina fossile.
  2. Poche gocce di olio di melaleuca possono essere aggiunte ai prodotti da bagno, oppure può essere usato come spray su biancheria da letto, tappezzeria, tappeti e altri tessuti.
  3. Gli oli essenziali possono essere usati per fare uno spray repellente per pulci fatto in casa. Gli oli comuni utilizzati includono eucalipto, menta piperita, melaleuca, palissandro, cedro, agrumi o citronella. Mescolare con acqua e mettere in un flacone spray.
  4. Usa trappole per pulci fatte in casa per sbarazzarti delle pulci. In una ciotola, aggiungi la stessa quantità di acqua calda e sapone liquido per le mani e posiziona la ciotola ai piedi del tuo letto con una piccola lampada accesa nelle vicinanze. Le pulci sono attratte dal calore della luce e cadranno nella trappola e annegheranno.
  5. Prima di passare l'aspirapolvere, cospargere la polvere di farina fossile e borace su tappeti, moquette e pavimenti. Il borace può essere irritante per la pelle e gli occhi, quindi tienilo lontano dalla portata dei bambini.
  6. Gli alberi di eucalipto sono noti per essere repellenti alle pulci e possono essere piantati nel cortile.

Le bombe delle pulci (nebulizzatori) non si assorbono bene nei tappeti, dove vivono le larve delle pulci. Per questo motivo, la maggior parte degli specialisti del controllo dei parassiti sconsiglia le bombe antipulci perché non le considera efficaci.

Alcuni rimedi naturali che possono aiutare a respingere le pulci negli animali domestici includono:

  1. Aggiungi piccole quantità di lievito di birra e aceto di mele all'acqua potabile del tuo animale domestico per respingere le pulci.
  2. L'aceto di mele diluito può essere utilizzato anche come risciacquo finale per gli animali domestici dopo il bagno.
  3. Gli shampoo a base di erbe per fare il bagno al tuo animale domestico includono eucalipto, lavanda, germanio, limone o melaleuca.
  4. L'aglio aggiunto al cibo del tuo animale domestico può aiutare a respingere le pulci.

Parla con il tuo veterinario dei modi per mantenere i tuoi cani e gatti liberi dalle pulci. Prima di utilizzare qualsiasi rimedio domestico o naturale per la prevenzione / repellenza delle pulci sui tuoi animali domestici, consulta il tuo veterinario. Alcuni rimedi funzionano bene per alcuni animali domestici e non per altri, e alcuni animali domestici potrebbero avere reazioni indesiderate a questi oggetti. La quantità di qualsiasi erba o olio o altro prodotto utilizzato per un animale domestico può variare a seconda delle dimensioni, del peso, dell'età, della razza e della salute generale. È sempre meglio consultare il tuo veterinario per assicurarti che i prodotti e le quantità che usi siano sicuri per i tuoi cani e gatti.

Devo avere un animale domestico per ricevere i morsi delle pulci?

Mentre la maggior parte delle infestazioni da pulci domestiche si verificano nelle case con animali domestici, le pulci possono infestare anche la casa senza animali domestici. Ciò può accadere in diversi scenari.

  • Se ti sei trasferito di recente in una casa in cui i precedenti proprietari avevano animali domestici con le pulci e non sono stati debitamente sradicati, potresti trovarti con un'infestazione da pulci.
  • I mobili usati possono essere infestati dalle pulci.
  • Cani o gatti del vicinato che hanno le pulci possono uscire vicino a casa tua
  • Anche parassiti come ratti o topi o animali selvatici come opossum, procioni, scoiattoli e puzzole possono trasportare le pulci e portarle nella tua casa.

Quali luoghi pubblici possono avere le pulci?

  • Un luogo pubblico comune dove si possono trovare le pulci è nei parchi per cani. Possono anche essere trovati in grandi parchi naturali che ospitano animali selvatici come opossum, procioni, scoiattoli e puzzole che possono trasportare le pulci.

Revisionato dal punto di vista medico 7/10/2019

Riferimenti

Ogg, Barb, PhD. “Controllo integrato delle pulci”. Università del Nebraska-Lincoln.

Dipartimento di Entomologia presso la Purdue University. “Pulci.”

Castells, MC, MD, PhD. “Morsi di insetto.” Aggiornato. Aggiornato: Kim 01, 2017.

Programma di educazione alla sicurezza dei pesticidi della Michigan State University. “Domande e risposte sulle pulci”.

National Park Service US Department of the Interior. “Office of Public Health – Flea Factsheet”.

Fleabites.net “Flea Bites on Humans – Pictures, Treatment and Prevention”.

Psorilax:Studio |crema cortisone psoriasi eucerin

0

Psorilax: prezzo, funziona, recensioni, opinioni, composizione

La psoriasi è una condizione della pelle con diverse classificazioni che coinvolgono tutte una risposta autoimmune. Può differire in:

E come altre malattie e disturbi autoimmuni, non esiste un ciclo di trattamento valido per tutti. Questo può rendere difficile trovare un trattamento che funzioni per te.

Potresti anche scoprire che il tuo trattamento diventa meno efficace nel tempo. Questo può accadere all'improvviso o gradualmente.

Ci sono una serie di ragioni comuni per cui un farmaco per la psoriasi può smettere di funzionare o potrebbe non essere altrettanto efficace nel tempo nella gestione dei sintomi. Loro includono:

1. Tolleranza ai farmaci

Il tuo corpo può sviluppare una tolleranza ai trattamenti topici dopo un periodo di uso continuo. I trattamenti topici sono sostanze che applichi direttamente sulla tua pelle. La tolleranza riduce la loro efficacia.

Può accadere sia con i corticosteroidi che con i trattamenti topici non steroidei. Questo processo è indicato dal punto di vista medico come tachifilassi.

2. Tossicità

La ricerca mostra che la tossicità può accumularsi nel corpo e influenzare i suoi organi con l'uso a lungo termine di farmaci sistemici convenzionali per il trattamento della psoriasi.

La tossicità è stata anche collegata all'insorgenza del cancro della pelle dopo la fototerapia a lungo termine. Quando ciò accade, dovrai consultare il tuo medico per opzioni di trattamento alternative.

3. Anticorpi anti-farmaco (ADA)

Il corpo a volte produce anticorpi in risposta sia ai farmaci sistemici convenzionali che ai farmaci biologici più recenti.

Gli ADA sono sostanze chimiche che il corpo produce per attaccare i farmaci, riducendo la loro efficacia.

I biologici sono farmaci più recenti sviluppati negli ultimi due decenni, realizzati da cellule viventi per colpire parti specifiche del sistema immunitario.

4. Stanchezza biologica

La tendenza dei farmaci biologici a perdere la loro efficacia con l'uso a lungo termine è nota come stanchezza biologica.

I ricercatori medici non capiscono del tutto perché ciò si verifica in alcune persone ma non in altre e con alcuni farmaci ma non con altri.

5. Effetti collaterali biologici

I biologici hanno un forte effetto sul sistema immunitario e possono aumentare il rischio di sviluppare infezioni. Per questo motivo, vengono generalmente utilizzati dopo aver provato prima altri trattamenti.

Il corpo può anche sviluppare una resistenza nei loro confronti nel tempo.

6. Infezione della pelle

Le infezioni della pelle possono rallentare i progressi del trattamento e alcuni farmaci per la psoriasi possono effettivamente peggiorare un'infezione. Se hai segni di un'infezione, come crosta o trasudamento, consulta subito il medico.

7. Diagnosi errata

Infezioni, eczema e dermatite da contatto possono imitare da vicino la psoriasi. Se non stai rispondendo al trattamento o il tuo trattamento smette di funzionare, è una buona idea chiedere al tuo medico se questa è una possibilità.

8. Dosi saltate

Ci sono molti motivi per cui potresti saltare una o due dosi del tuo farmaco. Alcuni trattamenti possono resistere a salti occasionali, ma altri si basano su un uso costante e coerente.

Se dimentichi spesso di prendere i farmaci, prova a utilizzare un'app o uno strumento di calendario che invia un promemoria quando è il momento della dose di quel giorno.

Se il costo è un problema, parla con il tuo medico di programmi di sconto sui farmaci o metodi di trattamento alternativi.

9. Stress

Lo stress può innescare riacutizzazioni della psoriasi, quindi trovare modi per gestirlo con successo può fare una grande differenza nella tua pelle e nella tua vita!

10. Combinazione necessaria

Un farmaco potrebbe non essere sufficiente per migliorare la psoriasi. Le creme per uso topico spesso funzionano meglio insieme a una crema alla vitamina D per la psoriasi da lieve a moderata.

La ricerca mostra che l'uso del farmaco sistemico metotrexato in combinazione con farmaci biologici è spesso più efficace di entrambi i farmaci da soli.

La fototerapia, o terapia della luce, è spesso più efficace in combinazione con farmaci topici.

11. It tci vuole più tempo

Sebbene i trattamenti topici a volte possano fare la differenza in giorni per la psoriasi lieve, i farmaci biologici a volte possono richiedere settimane o addirittura mesi per avere un effetto.

La fototerapia può richiedere da 15 a 25 trattamenti per funzionare, secondo la National Psoriasis Foundation. A volte, la pazienza è tutto ciò che serve per vedere un miglioramento dal tuo trattamento.

12. È il momento di cambiare lo stile di vita

Fumare e bere possono peggiorare i sintomi della psoriasi e ridurre le possibilità di remissione, secondo la National Psoriasis Foundation.

Bere può ridurre la risposta al trattamento ed è pericoloso se combinato con il metotrexato, un farmaco per la psoriasi sistemica.

Può essere frustrante vedere la tua pelle migliorare con una terapia per la psoriasi, solo per vedere i tuoi sintomi tornare mesi, o addirittura anni, su tutta la linea.

Questo può accadere con qualsiasi trattamento per la psoriasi:

  • attualità
  • sistemica convenzionale
  • biologico

Cosa fare dipende dal tipo di terapia che stai utilizzando. La prima cosa da sapere è che una diminuzione dell'efficacia è comune.

Probabilmente vorrai consultare il tuo medico per nuove opzioni. Di solito, ci sono modifiche che puoi apportare per trovare un trattamento che funzioni.

Prova i seguenti suggerimenti per riportare il trattamento in carreggiata.

Controlla il tuo programma

Assicurati di utilizzare o assumere i farmaci secondo il programma prescritto. Se hai saltato le dosi o non sei stato regolare nella tua applicazione topica, questo potrebbe essere il motivo per cui il farmaco non funziona.

Consulta il tuo medico

Se il tuo trattamento smette di funzionare, ti consigliamo di verificare con il tuo medico i passaggi successivi. Possono prescrivere un trattamento alternativo o aggiuntivo e verificare la tossicità, la tolleranza o gli ADA.

Raddoppiare

Il tuo medico potrebbe consigliare di combinare il trattamento con una terapia aggiuntiva. I farmaci biologici spesso funzionano meglio in combinazione con un farmaco sistemico convenzionale come il metotrexato.

Le creme per la pelle possono funzionare meglio con una terapia aggiuntiva con vitamina D. Un trattamento di fototerapia di combinazione noto come PUVA può essere molto efficace se combinato con un farmaco chiamato psoralene.

Dagli tempo

Alcuni trattamenti per la psoriasi, in particolare i biologici, possono richiedere fino a diversi mesi per iniziare a funzionare. Rivolgiti al tuo medico per assicurarti che le tue aspettative siano in linea con la tempistica del tuo farmaco.

Cambia abitudini

Fumare e bere alcolici in eccesso può influenzare sia i razzi della psoriasi che l'efficacia del trattamento.

Cambiamenti nello stile di vita sano, come smettere di fumare e bere moderatamente, nonché mantenersi attivi, seguire una dieta sana e controllare il proprio peso, possono aiutare a ridurre le riacutizzazioni della psoriasi.

Trova un gruppo di sostegno

Oltre a parlare con il tuo medico, potresti voler partecipare a un gruppo di supporto online per persone con psoriasi.

Il momento in cui un trattamento smette di funzionare può essere stressante e altri che hanno affrontato lo stesso problema potrebbero essere in grado di aiutare.

Ci sono molti segnali che potrebbe essere il momento di cambiare il trattamento della psoriasi. Forse il trattamento non funziona dall'inizio o smette di funzionare dopo un periodo di utilizzo riuscito.

Forse ci sono problemi di sicurezza sulla tossicità o il tuo corpo inizia a produrre ADA.

Potrebbero esserci effetti collaterali più fastidiosi di quanto tu voglia affrontare o forse semplicemente non ti piacciono alcuni aspetti del trattamento, come iniezioni quotidiane o applicazioni di crema che richiedono molto tempo.

Non esiste una singola serie di sintomi che dica che è ora di cambiare e nessun calendario generale per quando cambiare.

Ogni terapia differisce in:

  • problemi di sicurezza
  • quanto tempo ci vuole per lavorare
  • quando potrebbe smettere di funzionare

Anche ogni persona è diversa. Per motivi che i ricercatori medici non comprendono del tutto, lo stesso farmaco può influenzare persone diverse in modo diverso.

Ecco sette segnali che potrebbero essere il momento di parlare con il tuo medico della possibilità di cambiare il trattamento della psoriasi.

1. Il tuo trattamento non funziona

Non tutti i trattamenti funzionano per tutti. Alcuni trattamenti potrebbero non funzionare per te. Le creme topiche potrebbero non aiutare la pelle a schiarirsi e anche alcuni trattamenti sistemici potrebbero non portare miglioramenti.

Se hai somministrato regolarmente il tuo trattamento e gli hai dato abbastanza tempo per lavorare, e ancora non vedi miglioramenti, potrebbe essere il momento di cambiare.

2. Il trattamento smette di funzionare

All'inizio era tutto fantastico. La tua pelle ha iniziato a schiarirsi. Poi, settimane, mesi, persino anni dopo, i sintomi sono tornati. Questa è una storia fin troppo comune con tutti i tipi di terapie per la psoriasi.

Con il trattamento topico, il corpo può sviluppare una resistenza al farmaco nel tempo.

Con i farmaci sistemici convenzionali, così come i biologici, il corpo può produrre ADA che limitano l'efficacia del farmaco dopo mesi, o addirittura anni, di trattamento.

Il motivo per cui un farmaco smette di essere efficace non è del tutto compreso. Gli ADA potrebbero non raccontare l'intera storia.

Uno studio del 2013 pubblicato sul British Journal of Dermatology ha trovato solo una connessione tra ADA e diminuzione della risposta al trattamento nei partecipanti che assumevano due dei quattro farmaci biologici studiati.

Qualunque sia la ragione, quando il trattamento smette di funzionare, è tempo di considerare il passaggio. Alcuni medici raccomandano il passaggio anche prima che smetta di funzionare per evitare il ritorno dei sintomi.

3. La tua psoriasi progredisce

La progressione della psoriasi è imprevedibile e non del tutto compresa.

Una ricerca pubblicata nel Journal of Drugs in Dermatology nel 2018 sottolinea che alcuni casi di psoriasi possono rimanere stabili per anni.

In altri casi, la condizione può progredire rapidamente fino a coinvolgere organi, inclusi cuore, fegato, reni e intestino, nonché articolazioni e muscoli.

Se la tua psoriasi avanza, potrebbe superare il tuo trattamento attuale, che poi diventa meno efficace. A quel punto, vorrai parlare con il tuo medico di cure alternative.

4. Si sviluppano tossicità o effetti collaterali

Sia i farmaci sistemici convenzionali che i biologici possono avere gravi effetti collaterali.

La tossicità epatica è stata associata all'uso a lungo termine del farmaco convenzionale metotrexato, mentre la tossicità renale è stata associata all'uso a lungo termine della ciclosporina.

A causa di questo rischio, i farmaci sistemici convenzionali come il metotrexato, i retinoidi orali e la ciclosporina vengono in genere somministrati solo per un breve periodo.

I biologici hanno anche effetti collaterali. Poiché influenzano il sistema immunitario, possono aumentare il rischio di infezioni, come la tubercolosi e la polmonite, nonché le infezioni da stafilococco e fungine.

Se il tuo medico rileva che si verifica una qualsiasi di queste tossicità o gravi effetti collaterali, probabilmente dovrai modificare i trattamenti.

5. Si sviluppano altre condizioni

Secondo la National Psoriasis Foundation, le persone con malattia psoriasica hanno un rischio maggiore per altre malattie e disturbi, noti come comorbidità.

Le comorbilità, o condizioni coesistenti, che sono state associate alla psoriasi includono:

  • malattia cardiovascolare
  • depressione
  • malattie renali ed epatiche
  • osteoporosi
  • diabete
  • vari tipi di cancro, tra cui linfoma e melanoma

Anche un trattamento relativamente sicuro, come la fototerapia, può aumentare il rischio di cancro della pelle se la tua pelle è sensibile alla luce o se hai una storia familiare di disturbi della pelle.

Se sviluppi una condizione aggiuntiva, assicurati che il tuo medico coordini il trattamento della psoriasi con il nuovo trattamento. Potrebbe comportare la modifica del trattamento della psoriasi.

6. Sei incinta o stai allattando

La psoriasi di per sé non influenzerà la tua gravidanza o il tuo bambino, ma alcuni farmaci possono.

Alcuni farmaci biologici e sistemici, così come il catrame di carbone e alcuni altri trattamenti topici, dovrebbero essere evitati durante la gravidanza,

Una volta deciso di rimanere incinta, potrebbe essere necessario interrompere o modificare alcuni dei trattamenti per la psoriasi settimane, o addirittura mesi, prima di provare a concepire. Assicurati di consultare i tuoi operatori sanitari per discutere le tue opzioni.

Sarà più facile se provi a far sì che la tua psoriasi sia ben gestita prima di rimanere incinta. In questo modo, avrai meno riacutizzazioni durante la gravidanza e meno bisogno di cambi di farmaci.

7. Il tuo trattamento non raggiunge i tuoi obiettivi

Secondo la National Psoriasis Foundation, puoi aspettarti di essere in grado di sviluppare un programma di trattamento che schiarisce la tua pelle, ha pochi effetti collaterali e integra il tuo stile di vita, anche con psoriasi da moderata a grave.

Uno studio pubblicato su Dermatologic Study nel 2015 sottolinea che storicamente questa aspettativa non era sempre realistica.

Prima dello sviluppo dei farmaci biologici, ci si aspettava che le persone con psoriasi tollerassero un certo grado di problemi della pelle e un'ampia varietà di effetti collaterali dei farmaci.

Con l'ampia gamma di opzioni di trattamento ora disponibili, puoi lavorare per gestire con successo la tua condizione.

Puoi collaborare con il tuo medico per personalizzare l'efficacia, gli effetti collaterali e i requisiti dello stile di vita di vari trattamenti per sviluppare un programma che soddisfi i tuoi obiettivi di trattamento personali.

Ciò potrebbe comportare il cambio di trattamento più volte finché non ne trovi uno che funzioni per te.

Trovare il trattamento giusto per la tua psoriasi potrebbe richiedere del tempo, ma è possibile.

Fissa un appuntamento con il tuo medico se pensi che il tuo trattamento attuale non funzioni più.

Discuti i motivi per cui il tuo trattamento non funziona e quali opzioni di trattamento alternative sono adatte a te.

Psorilax:codice promozionale |crema psoriasi naturale

0

Psorilax: prezzo, funziona, recensioni, opinioni, composizione

Astratto

La relazione tra il sistema immunitario e l'epilessia è stata studiata per lungo tempo. L'attivazione immunitaria può precedere o seguire la comparsa di convulsioni. A seconda della situazione, l'immunità innata e acquisita può essere coinvolta a vari livelli. L'intensa ricerca in corso ha aperto prospettive di gestione e terapeutiche incoraggianti per un numero significativo di pazienti affetti da convulsioni. Questi includono l'uso di vari farmaci e approcci meno convenzionali con proprietà antinfiammatorie o immunomodulanti. I dati per i bambini rimangono scarsi, tuttavia, e le implicazioni pratiche delle recenti scoperte sul campo rimangono da identificare formalmente. Lo scopo di questa revisione è presentare le attuali conoscenze sul ruolo dell'immunità in relazione alle convulsioni, con particolare attenzione ai dati clinici disponibili durante l'infanzia. Più specificamente, vengono discussi vari autoanticorpi coinvolti nell'encefalite autoimmune ed epilessia e ipotesi fisiopatologiche generali sul ruolo dell'immunità nella genesi delle crisi convulsive, vengono sintetizzate le sindromi specifiche dell'epilessia in cui sono stati studiati i componenti autoimmuni, vengono suggerite raccomandazioni di workup e opzioni terapeutiche, e infine, vengono presentate domande aperte e esigenze future.

  • Abbreviazioni:
    Auto-AB
    autoanticorpi
    BBB
    barriera emato-encefalica
    CNS
    sistema nervoso centrale
    CSF
    liquido cerebrospinale
    GAD
    decarbossilasi di acido glutammico
    I L
    interleuchina
    IVIG
    immunoglobulina per via endovenosa
    LE
    encefalite limbica
    NMDA-R
    Recettore del glutammato di N-metile D-aspartato
    RTX
    rituximab
  • Il rischio di nuovi attacchi di insorgenza è particolarmente elevato durante l'infanzia. La prevalenza media di convulsioni ricorrenti non febbrili nei paesi sviluppati è compresa tra 3,5 e 5 per 1000 bambini,1,2 e il tasso di incidenza cumulativa dell'epilessia all'età di 15 anni è ∼0,8%. Nonostante enormi progressi nel campo dell'imaging e della genetica che hanno migliorato la comprensione dei meccanismi patofisiologici sottostanti,> il 60% dei disturbi convulsivi rimane senza una causa identificabile.3

    In un recente studio di ampia portata basato sulla popolazione (N = 2 518 034), i bambini con malattie autoimmuni avevano un rischio complessivo di epilessia 5 volte superiore rispetto ai controlli di età corrispondente.4 Questo rischio è stato costantemente accentuato in tutte le 12 malattie autoimmuni considerate, incluse alcune non note per influenzare la funzione del sistema nervoso centrale (SNC) come la miastenia grave o la psoriasi.4 In alcune di queste situazioni, specifici autoanticorpi (auto-AB) sono stati coinvolti nello sviluppo di segni e sintomi neurologici, ma restano da identificare precisi meccanismi patofisiologici.

    Inoltre, la funzione immunitaria è stata intensamente studiata in numerose malattie neurologiche primarie, tra cui le epilessie comuni per le quali resta da scoprire un'eziologia di base.5 Il riconoscimento dell'importanza dell'immunità nella fisiopatologia delle epilessie è illustrato dall'attuale intenzione della Lega internazionale contro l'epilessia di includere una nuova categoria di eziologia immunitaria nella sua proposta di Organizzazione delle epilessie.6 Nel complesso, la ricerca in corso in questo campo apre prospettive di gestione e terapeutiche incoraggianti per un numero significativo di adulti con convulsioni, ma i dati nei bambini rimangono scarsi.7 Poiché l'identificazione e l'intervento precoci mostrano sempre di più di migliorare il risultato generale, è importante avvisare i pediatri di questo specifico argomento.

    Di conseguenza, questo articolo presenta una panoramica dello stato attuale delle conoscenze sul coinvolgimento dell'immunità innata e adattiva nelle epilessie con un'enfasi sui dati pediatrici disponibili.

    Immunità ed epilessie: recenti progressi nella comprensione di una relazione complessa

    Dall'inizio degli anni '90 si è verificata un'esplosione del numero di studi scientifici sulla relazione tra autoimmunità ed epilessia. In alcune circostanze, l'attivazione immunitaria precede e provoca la comparsa di convulsioni. I dati della ricerca sugli animali indicano che al contrario, in altre situazioni, la cascata infiammatoria può essere attivata dalle convulsioni stesse. È generalmente accettato che un certo grado di reazione immunitaria sia favorevole e contribuisca alla protezione del cervello da danni permanenti dopo convulsioni; in determinate circostanze, tuttavia, questi processi immunitari possono essere deleteri.8 Inoltre, vari auto-AB sono stati associati a condizioni acute o croniche in cui i sequestri sono un segno distintivo, ma spesso non è chiaro se siano patogeni o se rappresentino semplicemente i marker di una malattia di base.

    Auto-AB correlati a convulsioni durante l'infanzia

    Numerosi Auto-AB sono stati oggetto di studio sull'epilessia negli anni passati.9 Di solito vengono identificate due categorie principali di auto-AB in base alla posizione dei loro antigeni target: la superficie intracellulare (probabilmente non patogena) o neuronale (probabilmente patogena). La loro presenza è stata dimostrata nel siero o nel liquido cerebrospinale (CSF) di molti pazienti con convulsioni, ma i ruoli precisi di molti auto-AB rimangono da comprendere appieno, specialmente nei bambini. Un recente articolo di revisione tratta ampiamente questo argomento.10 Conoscenza attuale1138 è sintetizzato nella tabella 1.

    TABELLA 1

    Auto-AB contro bersagli antigenici neuronali riportati nei bambini con convulsioni

    Le sindromi da encefalite autoimmune vengono sempre più definite dal biomarker auto-AB associato, come il recettore del glutammato N-metil D-aspartato (NMDA-R) AB. Tuttavia, molti pazienti con sospetta encefalite autoimmune non hanno un biomarcatore associato e quindi le sindromi cliniche rimangono importanti, la più importante delle quali è l'encefalite limbica (LE). La LE è un'encefalite infiammatoria che colpisce prevalentemente la regione limbica con alterazioni della memoria clinica, convulsioni del lobo temporale e sintomi psichiatrici ed è più comune negli adulti che nei bambini. Le risonanze magnetiche in genere mostrano infiammazione e gonfiore limitati nelle regioni limbiche bilaterali, gli EEG possono mostrare caratteristiche localizzanti e il liquido cerebrospinale può mostrare caratteristiche di infiammazione. Una serie di criteri diagnostici per LE è stata recentemente proposta da Graus et al.39 Diversamente dagli adulti, quando la LE è spesso associata ad auto-AB paraneoplastiche, la LE nei bambini è spesso sieronegativa (sebbene possa essere associata alle auto-AB dell'acido glutammico decarbossilasi (GAD)).17

    Epilessie o condizioni pediatriche specifiche in cui sono stati segnalati Auto-AB o caratteristiche disimmuni

    La maggior parte dei bambini che hanno convulsioni condividono alcune caratteristiche cliniche che probabilmente riflettono una partecipazione del sistema immunitario alle loro malattie.9 Questi includono un cambiamento (principalmente un aumento o, più raramente, una diminuzione) della frequenza delle crisi epilettiche durante periodi di malattie infettive o una risposta favorevole ad alcuni approcci immunoterapici. Alcuni degli auto-AB precedentemente descritti (così come ulteriori auto-AB non diretti principalmente contro obiettivi del SNC), citochinesi elevato e altri marcatori non specifici di un'attivazione immunitaria sono stati trovati in bambini con determinate sindromi da epilessia ben delineate, come Encefalite di Rasmussen,4059 Sindrome di West,21,23,30,60,61 Sindrome di Landau-Kleffner,6269 encefalopatia acuta con stato epilettico immuno-mediato,13,22,7084 e sclerosi temporale mesiale legata a precedenti convulsioni febbrili prolungate8590 (Tavolo 2). I meccanismi patofisiologici dettagliati rimangono da capire.

    TAVOLO 2

    Epilessie pediatriche o condizioni epilettiche in cui sono state segnalate caratteristiche disimmuni

    Vari meccanismi collegano l'attivazione e le convulsioni immunitarie

    È generalmente accettato che l'attivazione del sistema immunitario possa essere sia la conseguenza sia la causa delle convulsioni, che in entrambi i casi possono indurre cambiamenti funzionali permanenti nel sistema nervoso centrale. Questi stessi possono contribuire a generare convulsioni epilettiche.9193 Vari percorsi collegano la risposta immunitaria e le convulsioni. Questi includono risposte sistemiche adattive, come l'attivazione delle cellule T e B e la produzione di auto-AB, e meccanismi innati del sistema nervoso centrale, come l'aumento della produzione di citochine da parte delle cellule gliali attivate osservate in risposta a vari stimoli come le convulsioni. Quest'ultimo meccanismo è un processo recentemente identificato chiamato neuroinfiammazione neurogena, in cui le reazioni infiammatorie innate e adattive e l'attivazione delle cellule vascolari all'interno del sistema nervoso centrale sono innescate dall'attività nelle fibre nervose afferenti primarie o nei neuroni di ordine superiore.94 Sulla base di 5 recenti articoli di sintesi,91,9497 si può tentare di sintetizzare i passaggi più importanti che collegano il sistema immunitario e le convulsioni con i seguenti:

    1. Si verifica una lesione iniziale, nel sistema nervoso centrale o nella periferia, e provoca un'attivazione del sistema immunitario in uno o entrambi i compartimenti (sistemico o neuroinfiammatorio). Sono stati identificati vari eventi in grado di svolgere un ruolo del genere, tra cui infezioni periferiche, malattie autoimmuni, malattie vascolari del SNC (trombosi, emboli ed emorragia), vasculite, neurotrauma, disturbi metabolici, infezioni del sistema nervoso centrale, convulsioni e stato epilettico.

    2. I mediatori infiammatori vengono rilasciati in entrambi i compartimenti o in entrambi, a seconda della natura della lesione iniziale. Questi mediatori includono varie citochine (come l'interleuchina (IL) -1β, IL-6 e il fattore di necrosi tumorale-α), integrano le proteine, i cosiddetti segnali di pericolo (molecole che avvisano il microambiente di una lesione in corso, come gruppo di mobilità box-1 e la sua attivazione del recettore toll-like 4 nei neuroni e nelle cellule gliali), molecole di adesione cellulare, prostaglandine prodotte dall'attivazione della via di segnalazione cicloossigenasi-2 e chemochine. La sovraregolazione di questi mediatori e il loro rilascio da parte dei linfociti nella periferia, o da cellule gliali e neuronali attivate, possono a loro volta provocare la rottura della barriera emato-encefalica (BBB), l'adesione e la penetrazione dei linfociti periferici attivati, delle immunoglobuline e dell'albumina nel cervello ( e, per quest'ultimo, successiva attivazione della via di segnalazione del fattore di crescita trasformante-β), aumento della concentrazione di potassio extracellulare, nonché cambiamenti funzionali nei neuroni, nelle cellule gliali e negli astrociti.

    3. Si verificano cambiamenti funzionali neuronali, che aumentano la suscettibilità convulsiva. Esempi di questi cambiamenti funzionali includono la maggiore espressione di IL-1R1 (bersaglio e mediatore della risposta biologica a IL-1β) nei neuroni; l'attivazione di varie famiglie di chinasi intracellulari, come l'induzione della fosforilazione di una subunità di NMDA-R glutamatergica; l'inibizione del reuptake del glutammato o l'aumento del rilascio di glutammato nello spazio extracellulare da parte degli astrociti; la promozione della riorganizzazione sinaptica; e la disfunzione dei canali ionici. Studi di ricerca sugli animali hanno anche mostrato che alcuni geni che codificano per i mediatori della risposta infiammatoria, come IL-1, IL-6 (e il suo recettore) e IL-1β sono sovraregolati nella fase acuta che segue lo stato epilettico o trauma cranico .8,98

    Tutti questi meccanismi aumentano l'eccitabilità neuronale e abbassano la soglia convulsiva, il che crea un circolo vizioso di maggiore suscettibilità convulsiva. La ricerca sugli animali ha fornito dettagli riguardanti i vari meccanismi per l'epilettogenesi indotta da infiammazione. Questi includono la sopra menzionata maggiore adesione dei leucociti periferici attivati ​​alle cellule endoteliali seguita dalla loro infiltrazione nel sistema nervoso centrale attraverso la riorganizzazione del citoscheletro.99 Queste cellule generano radicali liberi ed enzimi citotossici che, oltre all'ulteriore produzione e secrezione di citochine e chemochine, partecipano alla disfunzione neuronale o alla degenerazione che contribuiscono alla comparsa di una successiva suscettibilità cronica alle convulsioni.95

    D'altra parte, un ruolo neuroprotettivo di CD3+ Le cellule T di controbilanciamento dell'infiammazione innata sono state evidenziate nei topi che soffrono di convulsioni indotte da acido kainico e ippocampi lesionati,100 lasciando così aperta la questione dell'esatto ruolo della risposta adattativa.

    Da un altro punto di vista, la relazione tra BBB e insorgenza di epilessia è stata ampiamente studiata per anni,101105 ma il modo in cui l'interruzione del BBB può provocare l'epilessia cronica rimane compreso in modo incompleto. È stato ipotizzato, ad esempio, che l'interruzione acuta della BBB dopo convulsioni iniziali causi cambiamenti prolungati o permanenti nella permeabilità cerebrale, che costituisce la base dell'eccitabilità neuronale circostante cronica e di ulteriori genesi delle convulsioni.106108 I recenti progressi nella teoria dell'interruzione del BBB aiuteranno probabilmente la nostra comprensione del processo. Bargerstock et al109 ha mostrato che S100B, una proteina astrocitica, viene rilasciata nella circolazione sistemica quando le giunzioni endoteliali BBB vengono interrotte, ad esempio, durante le convulsioni. Questo rilascio può a sua volta indurre una reazione autoimmune sistemica contro il cervello, che è alla base dello sviluppo di condizioni croniche nel sistema nervoso centrale, come l'epilessia e la malattia di Alzheimer. Questi risultati necessitano di conferma.

    Approcci terapeutici e prognosi

    Vari farmaci e molecole con proprietà antinfiammatorie o immunomodulanti hanno dimostrato di ridurre l'insorgenza di ulteriori attacchi epilettici in situazioni cliniche o sperimentali acute e di prevenire lo sviluppo di kindling ed epilessia negli animali.98,110117 I loro meccanismi di azione sono riassunti nella Tabella 3. Come regola generale, le situazioni in cui si trovano auto-AB neuronali e gli antigeni di superficie bersaglio (ad esempio, NMDA-R) hanno un tasso di risposta terapeutica molto più elevato rispetto a quelli in cui gli antigeni sono intracellulari, come GAD.118 I potenziali approcci immunitari per i bambini in varie condizioni epilettiche includono steroidi,119,120 immunoglobulina endovenosa (IvIg),121123 scambi di plasma,124,125 rituximab (RTX), ciclofosfamide e approcci alternativi come la dieta chetogenica, in cui le proprietà antinfiammatorie e neuroprotettive sono probabilmente i principali attori nei suoi meccanismi d'azione.70,97,126128

    TABELLA 3

    Esempi di farmaci e trattamenti con proprietà antinfiammatorie o immunomodulanti che hanno mostrato efficacia sperimentale o clinica nel trattamento delle convulsioni o nella prevenzione dello sviluppo dell'epilessia

    Due meta-analisi sull'uso di IvIg o interventi immunomodulatori in generale nell'epilessia hanno concluso che, sulla base dei dati disponibili, la loro efficacia non poteva essere dimostrata.129,130 Pertanto, rimane aperta la questione se le terapie antinfiammatorie o immunomodulanti debbano essere aggiunte ai classici farmaci antiepilettici in autoimmuni o anche in tutti i tipi di epilessie.

    In un recente studio, Irani et al131 ha riportato una rapida diminuzione e progressiva scomparsa totale delle convulsioni distoniche faciobrachiali nei 9 pazienti con ABs contro gliomi ricchi di leucina inattivati ​​1 proteina che sono stati trattati con steroidi in aggiunta ai farmaci antiepilettici iniziali a cui le convulsioni erano refrattarie.

    Allo stesso modo, Toledano et al132 selezionato 29 su 110 pazienti presso la loro clinica di neuroimmunologia che presentavano convulsioni come grave lamentela. Sono stati inclusi anche bambini di 2 anni. Questi pazienti erano sospettati di avere convulsioni di eziologia autoimmune sulla base della presenza di almeno 1 AB neurale, storia personale o familiare o stimmate fisiche di disturbi autoimmuni e convulsioni frequenti o refrattarie. È stato somministrato il trattamento con infusioni giornaliere di 1 g di metilprednisolone per via endovenosa o IvIg da 0,4 g / kg per 3-5 giorni, seguito da infusioni settimanali per 6-12 settimane alla stessa dose (da sola o in combinazione). Diciotto pazienti hanno risposto con una diminuzione della frequenza delle crisi, che è stata sostenuta nella maggior parte dei casi. Lo studio ha portato prove di classe IV che queste opzioni terapeutiche hanno migliorato il controllo delle crisi.132

    Il ruolo degli agenti che modificano la funzione del sistema immunitario innato e attenuano la neuroinfiammazione, come le cellule staminali mesenchimali mesenchimali che secernono β, la melatonina,133136 sta emergendo. In uno studio recente, la minociclina ha dimostrato di migliorare i comportamenti adattivi di alcuni bambini con sindrome di Angelman, sebbene l'esatto meccanismo d'azione potrebbe essere multifattoriale.137 Resta da valutare se queste molecole abbiano un ruolo da svolgere nella gestione di alcune forme di epilessia. Un altro tema importante e attuale in neuroimmunologia è che la terapia precoce ha maggiori probabilità di essere efficace rispetto al trattamento successivo nell'encefalite autoimmune, che è stato recentemente dimostrato in una revisione approfondita della letteratura.138

    Implicazioni pratiche dei dati disponibili e comprensione attuale nella gestione dei bambini con convulsioni

    Quando si dovrebbe sospettare clinicamente un bambino con convulsioni di eziologia immunitaria?

    Suleiman et al139 ha proposto un diagramma di flusso per avvicinare i bambini con sospetti attacchi autoimmuni. Allo stesso modo, Bien118 ha proposto una tabella dettagliata delle caratteristiche cliniche e paracliniche che dovrebbero stimolare la ricerca di auto-AB nei pazienti con epilessia. Più recentemente, Graus et al39 ha proposto un approccio clinico alla diagnosi di encefalite autoimmune, che ha sottolineato che il sospetto clinico dovrebbe comportare una terapia immunitaria di prima linea piuttosto che attendere i risultati di auto-AB. Sulla base di queste proposte, proponiamo che le analisi della funzione immunitaria debbano essere specificamente prese in considerazione nei bambini se sono presenti 3 di questi 5 criteri (Fig. 1): (1) frequenza insolitamente alta di convulsioni dall'inizio, con refrattarietà precoce ai classici farmaci antiepilettici; (2) ulteriori segni clinici di insorgenza acuta o subacuta, che suggeriscono un coinvolgimento diffuso del SNC (come disturbi psichiatrici o comportamentali, disturbi della coscienza, movimenti anomali o problemi del sonno); (3) la presentazione clinica orienta chiaramente una sindrome associata alla presenza di specifici auto-AB; (4) presenza di una storia personale o familiare di malattia autoimmune; e (5) la presentazione clinica non si orienta a sindromi da epilessia ben circoscritte e rapidamente identificabili, e lesioni strutturali e le malattie infettive, metaboliche o tossiche sono escluse dalla storia e dalle prime ricerche.

    FIGURA 1
    FIGURA 1

    Bambini con convulsioni di sospetta eziologia immunitaria: caratteristiche cliniche suggestive e approccio diagnostico graduale proposto. FLAIR, recupero dell'inversione dell'attenuazione del fluido; T2, tempo di rilassamento trasversale.

    Inoltre, alcune infezioni sono note per scatenare l'encefalite e l'epilessia nei bambini. Alcuni di essi infettano direttamente il cervello e causano un'encefalite virale primaria; d'altra parte, alcuni microrganismi possono indurre un'encefalite autoimmune secondaria, come l'encefalite anti-NMDA-R indotta da herpes simplex o varicella zoster.140142 In alcune di queste sindromi da encefalite infettiva o postinfettiva, ci sono prove di autoimmunità e biomarcatori specifici (come NMDA-R AB), mentre in altre sindromi non esiste un biomarcatore specifico e l'esatto meccanismo infiammatorio non è chiaro. Gli studi sull'epilessia postencefalitica hanno dimostrato che l'herpes simplex e il micoplasma hanno il più alto potenziale per provocare un'epilessia in corso.143,144 In questi studi, gravi indicatori clinici come lo stato epilettico erano fattori di rischio per la successiva epilessia farmacoresistente. Recentemente, l'auto-AB contro il leimodin-1, una proteina intracellulare che si esprime nel tessuto muscolare liscio e nella tiroide ma anche nel citoplasma dei neuroni, è stata trovata nel siero e nel liquido cerebrospinale di alcuni bambini dell'Africa orientale con sindrome di annuendo, un disturbo epilettico finora inspiegabile ed epidemico associato al verme parassita Onchocerca volvulus.145

    La reattività alla terapia immunitaria è indicativa di epilessia autoimmune, ma ciò è possibile solo a posteriori. La variabilità o la multifocalità delle crisi intraindividuali e la storia di neoplasia sono state correlate all'epilessia autoimmune negli adulti e dovrebbero anche essere considerate come caratteristiche suggestive nei bambini. È importante notare che l'assenza di queste caratteristiche non può escludere definitivamente l'epilessia autoimmune.

    Inoltre, alcuni pazienti con encefalite autoimmune non presentano alcun sintomo clinico oltre alle convulsioni.146 È probabile che queste osservazioni siano rare, in particolare durante l'infanzia, e non crediamo che tutti i bambini che presentano convulsioni debbano essere indagati per un'eziologia immunitaria in assenza di altre caratteristiche cliniche o sperimentali che suggeriscono infiammazione.

    Queste limitazioni sottolineano il fatto che lo spettro dell'epilessia autoimmune deve ancora essere definito e sono necessari nuovi CSF o biomarcatori del sangue.

    Come dovrebbe essere indagato un bambino con convulsioni di sospetta eziologia immunitaria?

    Ci sono stati grandi progressi nella nostra comprensione dei ruoli degli auto-AB come mediatori e biomarcatori nell'epilessia autoimmune, ma è probabile che molte sindromi abbiano meccanismi cellulari o immunitari innati che sono scarsamente riconosciuti. Profili di biomarcatori più ampi tra cui citochine e / o chemochine, tecniche molecolari e studi di imaging dei ligandi miglioreranno sicuramente la nostra capacità di identificare l'infiammazione del SNC in futuro.

    Suggeriamo che le analisi del sangue mirate per gli auto-AB più probabili in base alla presentazione clinica, l'uso di biochip (mosaici di cellule che mostrano vari antigeni, come quelli descritti nella Tabella 1),118 e una risonanza magnetica cerebrale con tempo di rilassamento trasversale e sequenze di recupero dell'inversione dell'attenuazione del fluido dovrebbero essere le procedure minime eseguite inizialmente nei bambini con convulsioni di sospetta eziologia immunitaria. Poiché le analisi del sangue possono portare a risultati non specifici (positivi o negativi), è necessario eseguire una puntura lombare per cercare un aumento del numero di proteine ​​o cellule, bande oligoclonali e produzione intratecale di auto-AB. Un ELETTROENCEFALOGRAMMA standard può portare ulteriori indizi in situazioni specifiche, come quando si sospetta l'encefalite NMDA-R ed è presente un modello di pennello δ estremo (sebbene questa funzionalità abbia una bassa sensibilità).26,147 Dovrebbe essere preso in considerazione anche un esame esteso del sangue, del liquido cerebrospinale e delle urine per le malattie autoimmuni sistemiche, specialmente in quelli con coinvolgimento multiorgano (Tabella 4). Questo workup include marcatori di funzionalità epatica e renale, tassi di sedimentazione eritrocitaria, proteine ​​del complemento, vari auto-AB riscontrati nel lupus eritematoso sistemico o vasculitidi, nonché auto-AB associati alla malattia autoimmune della tiroide (che si deve ricordare rappresenta una predisposizione all'autoimmunità e alla malattia autoimmune della tiroide piuttosto che un marker patogeno di epilessia autoimmune). Le ricerche tumorali devono essere eseguite in base al potenziale riscontro di auto-AB specificamente associati a tumori maligni, come i teratomi ovarici nelle ragazze con NMDA-R auto-AB. Può anche essere utile la ricerca di marcatori non specifici dell'attivazione immunitaria nel sistema nervoso centrale, come neopterina del CSF o bande oligoclonali.148,149

    TABELLA 4

    Indagine proposta su convulsioni ed epilessia di sospetta eziologia immunitaria

    È urgente sviluppare marcatori affidabili dell'attivazione immunitaria del SNC, che attualmente sono carenti o non ampiamente disponibili. Questi probabilmente includeranno citochine e chemiochine CSF ed EEG o funzionalità di imaging. Un esempio di quest'ultimo è stato fornito di recente da un 11Studio di tomografia ad emissione di positroni di c-acetato di 23 pazienti adulti con epilessia derivante dal lobo temporale in cui è stato dimostrato un aumento del legame di uno di questi marcatori, la proteina traslocatrice 18 kDa, ipsilateralmente e contralateralmente per colpire i fuochi, il che suggerisce un'infiammazione diffusa in corso.150 In un altro studio, il tentativo di rilevare caratteristiche EEG specifiche in pazienti con epilessia e vari AB antineuronali non è riuscito a definire le caratteristiche discriminanti.151 Tuttavia, ci sono indicatori EEG acuti di scarso esito nei bambini con encefalite.152 Pertanto, l'EEG può anche essere utile in termini di prognosi.

    Come dovrebbe essere trattato un bambino con convulsioni di eziologia immunitaria dimostrata (o fortemente sospettata)?

    I classici schemi di trattamento utilizzati in altre malattie neurologiche autoimmuni possono essere applicati anche a convulsioni ed epilessia dell'etiologia immunitaria. Le attuali raccomandazioni per l'encefalite autoimmune, come l'encefalite NMDA-R AB, comprendono metilprednisolone per via endovenosa a 30 mg / kg al giorno per 3-5 giorni (≤1 g) seguita da steroidi pulsati mensili in corso, prednisone orale o prednisolone da 1 a 2 mg / kg al giorno per 2-4 settimane e una conicità lenta.118,139,153 Questo approccio dovrebbe essere preso in considerazione non appena sorge il sospetto di eziologia autoimmune, sia in situazioni croniche che acute.39 Come specificamente dimostrato in condizioni come l'encefalite NMDA-R,153155 trattamento aggressivo compresi ≥4-10 scambi di plasma118 seguito da IvIg a 2 g / kg diviso per 2-5 dosi (o IvIg seguito da scambi di plasma dopo un intervallo minimo di 2 settimane)156 e varie combinazioni di farmaci immunosoppressori (incluso RTX per via endovenosa a 375 mg / m2 ogni settimana, 2-4 volte; e ciclofosfamide endovenosa a 750 mg / m2 mensile per 3-6 mesi)118 dovrebbe essere rapidamente considerato in combinazione con steroidi in gravi malattie.

    È importante sottolineare che questo schema di trattamento è stato proposto per l'epilessia autoimmune e / o l'encefalite e potrebbe non essere efficace in altre sindromi da epilessia disimmune. Dato che l'attivazione immunitaria nel sistema nervoso centrale può essere protettiva, il miglior approccio terapeutico per i pazienti con sospetta ma non confermata epilessia immuno-mediata rimane incerto. Nella Fig. 2, proponiamo uno schema di sperimentazione di immunoterapia che potrebbe essere seguito in futuri studi prospettici di sospetta epilessia immunitaria o autoimmune.138,157

    FIGURA 2
    FIGURA 2

    Una guida alla sperimentazione di terapia immunitaria. La durata della sperimentazione immunitaria dipende dallo scenario clinico. In generale, lo studio terapeutico deve essere sufficientemente lungo per determinare l'effetto e, in condizioni più gravi, lo studio deve essere sostenuto o addirittura ridotto.138,157 Gli steroidi devono essere considerati per tutti i pazienti con sospetta epilessia autoimmune. In casi fortemente sospetti o con provata reattività e / o dipendenza da steroidi, devono essere prese in considerazione altre terapie immunitarie come IvIg, RTX, ciclofosfamide e agenti risparmiatori di steroidi come il micofenolato mofetile.

    conclusioni

    Ora è chiaro che l'infiammazione e l'autoimmunità svolgono un ruolo importante nelle convulsioni e nelle epilessie infantili. Queste reazioni immunitarie possono essere la causa di convulsioni, ad esempio quando vengono prodotti auto-AB contro vari bersagli del SNC coinvolti nell'attivazione neuronale. D'altra parte, varie risposte immunitarie periferiche e del sistema nervoso centrale vengono attivate dopo convulsioni. Questi ultimi meccanismi sono racchiusi nel concetto recentemente descritto di neuroinfiammazione neurogena, che può comportare l'attivazione di una cascata antinfiammatoria e meccanismi omeostatici con conseguente neuroprotezione e interruzione di convulsioni o la perpetuazione di una risposta immunitaria disadattata e neurotossica come base di ulteriore genesi dell'epilessia.94 Le domande importanti che rimangono aperte includono la comprensione dei tempi e della sequenza precisi degli elementi della risposta immunitaria alle convulsioni, il rilevamento di biomarcatori diagnostici affidabili dell'infiammazione del SNC nei bambini con epilessie, l'identificazione di specifiche caratteristiche cliniche, radiologiche ed elettrofisiologiche che possono consentire il sospetto precoce dell'epilessia immunitaria e lo sviluppo di strategie terapeutiche e molecole ottimali mirate contro i vari mediatori infiammatori sopra descritti attraverso studi prospettici controllati.

    Ringraziamenti

    Ci rivolgiamo i nostri più sentiti ringraziamenti al dott. Douglas R. Nordli Jr, a Los Angeles per i suoi utili suggerimenti nelle fasi iniziali del manoscritto.

    Le note

    • Indirizzo per corrispondenza a Christian M. Korff, MD, Unità di neurologia pediatrica, Dipartimento per bambini e adolescenti, Ospedali universitari di Ginevra, 6 Rue Willy-Donzé, CH 1211 Ginevra 14, Svizzera. E-mail: christian.korff at hcuge.ch
    • INFORMATIVA FINANZIARIA: Gli autori hanno indicato di non avere relazioni finanziarie rilevanti per questo articolo da divulgare.

    • FINANZIAMENTO: Nessun finanziamento esterno.

    • POTENZIALE CONFLITTO DI INTERESSI: Gli autori hanno indicato di non avere potenziali conflitti di interesse da rivelare.

    Psorilax:Più veloce |crema mani svr psoriasi

    0

    Psorilax: prezzo, funziona, recensioni, opinioni, originale

    Questo medicinale è soggetto a monitoraggio addizionale. Ciò consentirà una rapida identificazione
    di nuove informazioni sulla sicurezza. Puoi aiutare segnalando eventuali effetti collaterali che potresti avere.
    Puoi segnalare gli effetti collaterali al tuo medico o direttamente su www.tga.gov.au/reporting-problems.

    Autoiniettore preriempito e siringa preriempita

    Ixekizumab (rch) (pronunciato ixe-kiz-u-mab)

    Informazioni sulla medicina dei consumatori

    Cosa c'è in questo foglio

    Questo opuscolo ha lo scopo di fornire risposte ad alcune domande comuni su
    questo medicinale.

    Tutti i farmaci hanno rischi e benefici. Il tuo medico ha maggiori informazioni su questo
    medicinale che è contenuto in questo foglio.

    In caso di dubbi sull'uso di questo medicinale, si rivolga al medico o al farmacista.

    Conservi questo foglio con il medicinale.

    Potrebbe essere necessario leggerlo di nuovo.

    A cosa serve TALTZ

    TALTZ è usato per trattare:

    psoriasi a placche

    artrite psoriasica

    spondilite anchilosante (nota anche come spondiloartrite assiale radiografica).

    La psoriasi a placche è una condizione della pelle causata da un'infiammazione che colpisce la pelle. TALTZ
    riduce l'infiammazione e altri sintomi della malattia, come desquamazione, prurito e
    dolore. TALTZ è usato in pazienti adulti con psoriasi a placche da moderata a grave che
    sono candidati alla terapia sistemica o alla fototerapia.

    L'artrite psoriasica è una malattia infiammatoria delle articolazioni, spesso accompagnata da
    psoriasi. Ti verranno somministrati prima altri medicinali per il trattamento dell'artrite psoriasica, ma
    può ricevere TALTZ se non risponde bene a questi medicinali. TALTZ può essere utilizzato
    da solo o con altri medicinali, come il metotrexato.

    La spondilite anchilosante è una malattia infiammatoria che colpisce principalmente la colonna vertebrale che
    provoca infiammazione delle articolazioni sacroiliache e spinali.

    TALTZ contiene il principio attivo ixekizumab. Ixekizumab è un anticorpo monoclonale.
    Gli anticorpi monoclonali sono proteine ​​che riconoscono e si legano specificamente a determinati
    proteine ​​nel corpo.

    TALTZ appartiene a un gruppo di medicinali chiamati inibitori dell'interleuchina (IL). TALTZ funziona
    neutralizzando l'attività della proteina chiamata IL-17A, presente in alta
    livelli nella psoriasi.

    TALTZ non è stato studiato in pazienti di età inferiore a 18 anni.

    TALTZ può essere utilizzato nei pazienti anziani di età pari o superiore a 65 anni.

    TALTZ è disponibile solo su prescrizione medica.

    TALTZ non crea dipendenza.

    Chiedi al tuo medico, infermiere o farmacista se hai domande sul motivo di questo medicinale
    è stato prescritto per te.

    Prima di usare TALTZ

    Informi il medico se si dispone di una delle seguenti condizioni o se si è mai verificato
    una qualsiasi di queste condizioni.

    Quando non devi usare TALTZ

    Non usi TALTZ:

    se è allergico a ixekizumab o ad uno qualsiasi degli ingredienti elencati alla fine di
    questo foglio illustrativo (vedere “Descrizione del prodotto”).

    Alcuni dei sintomi di una reazione allergica possono includere:

    oppressione toracica, respiro sibilante o difficoltà a respirare

    forti capogiri o stordimento

    gonfiore del viso, delle labbra, della lingua, della gola o di altre parti del corpo

    eruzione cutanea, prurito o orticaria sulla pelle

    Se pensi di essere allergico, chiedi consiglio al tuo medico prima di usare TALTZ.

    se il prodotto appare torbido, scolorito o contiene particelle

    se la confezione è strappata o mostra segni di manomissione

    se la data di scadenza (Scad.) sulla confezione è stata superata.

    Se il medicinale è scaduto o è danneggiato, restituirlo al farmacista per lo smaltimento.

    Se non sei sicuro di iniziare a usare TALTZ, parla con il tuo medico, infermiere
    o farmacista.

    Prima di iniziare a usare TALTZ

    Informi il medico prima di usare TALTZ:

    se ha attualmente un'infezione o se ha infezioni a lungo termine o ripetute

    se soffre di tubercolosi

    se soffre di colite ulcerosa o morbo di Crohn

    se ha subito una vaccinazione di recente o se deve sottoporsi a una vaccinazione durante
    trattamento con TALTZ

    se sta ricevendo altri trattamenti per la psoriasi, come gli immunosoppressori
    o fototerapia con luce ultravioletta (UV).

    Informa il tuo medico della tua storia di vaccinazioni.

    I vaccini vivi non possono essere utilizzati durante il trattamento con TALTZ. Dovresti considerare di completare
    tutte le vaccinazioni richieste per la tua fascia d'età prima di iniziare con TALTZ.

    Potresti essere sottoposto a test per la tubercolosi prima di ricevere il trattamento con TALTZ.

    Informi il medico se è incinta, se pensa di essere incinta o se intende diventarlo
    incinta.

    Gli effetti di TALTZ nelle donne in gravidanza non sono noti. Parla con il tuo medico del
    benefici per te che usi TALTZ rispetto al potenziale rischio per il tuo bambino non ancora nato.

    Informi il medico se sta allattando o prevede di allattare.

    Non è noto se TALTZ sia escreto nel latte materno. Parla con il tuo medico dell'allattamento al seno
    prima di prendere TALTZ.

    Informi il medico di queste cose prima di usare TALTZ.

    Assunzione di altri medicinali

    Informi il medico se sta assumendo altri medicinali, compresi quelli acquistati
    senza prescrizione da farmacia, supermercato o negozio di alimenti naturali.

    Informi il medico, l'infermiere o il farmacista se:

    sta usando, ha usato di recente o potrebbe usare qualsiasi altro medicinale.

    ha avuto recentemente o deve sottoporsi a una vaccinazione. Non dovresti essere dato certo
    tipi di vaccini durante l'utilizzo di TALTZ.

    Come usare TALTZ

    Seguire attentamente tutte le indicazioni fornite dal medico, dall'infermiere o dal farmacista.

    Questi possono differire dalle informazioni contenute in questo foglio.

    Se non capisci le istruzioni, chiedi al tuo medico, infermiere o farmacista
    Aiuto.

    Ogni autoiniettore o siringa contiene una dose di TALTZ (80 mg).

    TALTZ viene somministrato come iniezione sotto la pelle, nota come iniezione sottocutanea.

    Tu e il tuo medico, infermiere o farmacista dovreste decidere se iniettare TALTZ
    te stesso.

    La prima dose verrà somministrata da un medico, un infermiere o un farmacista. Non è importante
    provare a iniettarsi da solo fino a quando non è stato addestrato da un medico, un infermiere o un farmacista.
    Un caregiver può anche somministrarti l'iniezione di TALTZ dopo un adeguato addestramento.

    Quanto usare

    Psoriasi a placche

    La prima dose di TALTZ per la psoriasi a placche è di 160 mg (due iniezioni da 80 mg), seguita
    di 80 mg (una iniezione) alle settimane 2, 4, 6, 8, 10 e 12.

    Dopo 12 settimane, il trattamento continuerà come 80 mg (una iniezione) ogni 4 settimane.

    Artrite psoriasica

    La prima dose di TALTZ per l'artrite psoriasica è di 160 mg (due iniezioni da 80 mg),
    seguito da 80 mg (una iniezione) ogni 4 settimane.

    Se soffre di artrite psoriasica con psoriasi da moderata a grave, la prima dose
    di TALTZ è di 160 mg (due iniezioni da 80 mg), seguito da 80 mg (una iniezione) a settimane
    2, 4, 6, 8, 10 e 12.

    Dopo 12 settimane, il trattamento continuerà come 80 mg (una iniezione) ogni 4 settimane.

    Spondilite anchilosante

    La dose di TALTZ per la spondilite anchilosante è di 80 mg (una iniezione) ogni 4 settimane.

    Deve iniettare l'intero contenuto dell'autoiniettore o della siringa monouso.

    Come usarlo

    Leggere attentamente le istruzioni per l'uso dell'autoiniettore o della siringa prima dell'uso
    TALTZ.

    Quanto tempo lo uso

    TALTZ è per il trattamento a lungo termine. Il medico, l'infermiere o il farmacista lo faranno regolarmente
    monitorare le sue condizioni per verificare che il trattamento stia avendo l'effetto desiderato.

    Non interrompere TALTZ solo perché ti senti meglio. È importante che non ti fermi
    usando TALTZ a meno che non glielo dica il medico.

    Non è pericoloso smettere di usare TALTZ. Tuttavia, se si interrompe, i sintomi della psoriasi
    potrebbe tornare.

    Se salta una dose

    Se ha dimenticato di iniettare una dose di TALTZ, inietti la dose successiva non appena lei
    ricorda. Quindi parli con il medico per discutere quando deve iniettare la dose successiva.

    Se ha ulteriori domande sull'uso di questo medicinale, chieda al medico, all'infermiere
    o farmacista.

    Se usa più del dovuto (sovradosaggio)

    Se ha iniettato accidentalmente più TALTZ di quanto avrebbe dovuto o prima di quanto indicato
    la ricetta del tuo medico, telefona immediatamente al tuo medico o all'Ufficio Informazioni sui veleni
    Center (telefono 13 11 26 per l'Australia) per un consiglio, o andare a Infortuni ed emergenze
    all'ospedale più vicino, se pensi che tu o qualcun altro possa aver preso troppo
    TALTZ.

    Fallo anche se non ci sono segni evidenti di disagio o avvelenamento.

    Mentre usi TALTZ

    Cose che devi fare

    Mantieni tutti gli appuntamenti del tuo medico in modo che i tuoi progressi possano essere controllati.

    Di tanto in tanto il medico eseguirà dei test per assicurarsi che TALTZ funzioni e per prevenire
    effetti collaterali indesiderati.

    Se ha bisogno di essere vaccinato, informi il medico che sta assumendo TALTZ prima di averlo
    la vaccinazione.

    Non deve ricevere una vaccinazione viva durante il trattamento con TALTZ.

    Dì a tutti i medici, dentisti e farmacisti che ti stanno curando che stai usando
    TALTZ.

    Mentre sta usando TALTZ, informi il medico o il farmacista prima di iniziare qualsiasi nuovo
    medicinale.

    Informi il medico se rimane incinta o sta pianificando di allattare durante l'utilizzo di TALTZ.

    Cose che non devi fare

    Non usi il medicinale se pensi che sia stato congelato o esposto a calore eccessivo.

    Potrebbe non funzionare altrettanto bene.

    Non usi il medicinale se nota che l'autoiniettore o la siringa sono danneggiati,
    oppure il medicinale è torbido, chiaramente marrone o contiene particelle.

    Non dare il tuo TALTZ a nessun altro, anche se ha le tue stesse condizioni.

    Il medico ha prescritto TALTZ appositamente per lei.

    Effetti collaterali

    Informi il medico o il farmacista il prima possibile se non ti senti bene mentre stai
    stanno usando TALTZ.

    Come tutti i medicinali, TALTZ può causare alcuni effetti collaterali indesiderati, sebbene non tutti
    li ottiene.

    Informi il medico il prima possibile di eventuali effetti collaterali indesiderati.

    Tutti i medicinali possono avere effetti collaterali. A volte sono seri, il più delle volte
    non sono. Potrebbe essere necessario un trattamento medico se si verificano alcuni degli effetti collaterali.

    Chiedi al tuo medico o farmacista di rispondere a qualsiasi domanda tu possa avere.

    Informi immediatamente il medico o si rechi al pronto soccorso dell'ospedale più vicino se se ne accorge
    uno dei seguenti:

    Segni di reazioni allergiche gravi come difficoltà a respirare o deglutire

    Gonfiore del viso, delle labbra, della lingua o della gola

    Grave prurito della pelle, con eruzione cutanea rossa o protuberanze in rilievo.

    Smetta di usare TALTZ e informi immediatamente il medico se manifesta uno dei seguenti sintomi
    effetti collaterali. Il medico deciderà se e quando potrà riprendere il trattamento.

    Possibili infezioni gravi – i segni possono includere:

    febbre, sintomi simil-influenzali, sudorazioni notturne

    sensazione di stanchezza o mancanza di respiro, tosse che non andrà via

    pelle calda, arrossata e dolorosa o eruzione cutanea dolorosa con vesciche.

    Informi il medico se manifesta uno dei seguenti effetti collaterali:

    infezioni del tratto respiratorio superiore con sintomi come mal di gola e naso chiuso

    reazioni al sito di iniezione (ad es. pelle arrossata o dolore)

    nausea (sensazione di malessere)

    piede d'atleta (tinea)

    dolore nella parte posteriore della gola

    febbre, mal di gola o ulcere alla bocca dovute a infezioni.

    mal di stomaco o diarrea a causa di malattie infiammatorie intestinali (inclusa ulcerosa
    colite o morbo di Crohn).

    L'elenco sopra include più degli effetti collaterali comuni. Di solito sono da lievi a
    moderato e di breve durata.

    Altri effetti collaterali non comuni includono:

    mughetto orale

    influenza

    rinorrea

    orticaria

    scarico dagli occhi con prurito, arrossamento e gonfiore.

    Non allarmarti per questo elenco di effetti collaterali.

    Potresti non sperimentarne nessuno.

    Nuovi casi di malattia infiammatoria intestinale o “riacutizzazioni” possono verificarsi con TALTZ, e
    a volte può essere serio.

    Se ha una malattia infiammatoria intestinale (colite ulcerosa o morbo di Crohn), informi
    il medico se ha un peggioramento dei sintomi durante il trattamento con TALTZ o sviluppa
    nuovi sintomi di mal di stomaco o diarrea.

    Informi il medico se nota qualcosa di insolito o se è preoccupato
    aspetto della tua salute, anche se pensi che i problemi non siano collegati a questo
    medicinale e non sono menzionati in questo foglio.

    In alcune persone possono verificarsi anche altri effetti collaterali non elencati sopra.

    Dopo aver usato TALTZ

    Conservazione

    Un autoiniettore o una siringa TALTZ è esclusivamente monouso.

    Conserva l'autoiniettore o la siringa TALTZ inutilizzati in un frigorifero tra 2 ° C e 8 ° C. Fare
    non congelare o agitare.

    Non utilizzarlo se è stato congelato.

    Tenere TALTZ nella confezione originale per proteggerlo dalla luce.

    Se necessario, l'autoiniettore o la siringa TALTZ possono essere lasciati fuori dal frigorifero per
    fino a 5 giorni a una temperatura non superiore a 30 ° C, ad esempio durante il viaggio o il trasporto
    dalla farmacia. Dopo 5 giorni fuori dal frigorifero, l'autoiniettore TALTZ
    o la siringa deve essere utilizzata o eliminata.

    Non utilizzare un autoiniettore o una siringa dopo la data di scadenza stampata sul
    etichetta e scatola esterna dopo “Scad.” (mese / anno).

    La data di scadenza si riferisce all'ultimo giorno di quel mese.

    Tutti i medicinali devono essere tenuti fuori dalla vista e dalla portata dei bambini.

    Disposizione

    Se il medico ti dice di smettere di usare TALTZ o trovi l'autoiniettore o la siringa
    ha superato la data di scadenza, restituirlo al farmacista.

    Gli autoiniettori e le siringhe vuoti devono essere smaltiti in un contenitore per materiali taglienti o simile
    contenitore antiforatura composto da plastica dura o vetro.

    Chieda al medico, all'infermiere o al farmacista dove è possibile smaltire il contenitore una volta esaurito
    è pieno.

    È inoltre possibile fare riferimento alle “Istruzioni per l'uso” dell'autoiniettore o della siringa per ulteriori informazioni
    informazioni sulla conservazione e la manipolazione di questo medicinale.

    Descrizione del prodotto

    Cosa sembra

    TALTZ è una soluzione iniettabile limpida. Il suo colore può variare da incolore a leggermente
    giallo.

    TALTZ è disponibile come autoiniettore (noto anche come penna) e siringa preriempita
    in confezioni da 1 o 2.

    Non tutte le confezioni potrebbero essere disponibili.

    ingredienti

    Principio attivo:

    ixekizumab (rch) (80 mg)

    Ingredienti inattivi:

    citrato di sodio diidrato

    acido citrico

    cloruro di sodio

    polisorbato 80

    acqua per preparazioni iniettabili

    Fornitore

    Fornito in Australia da:

    Eli Lilly Australia Pty Limited

    112 Wharf Road

    OVEST RYDE, NSW 2114

    www.lilly.com.au

    Numeri di registrazione australiani:

    Autoiniettore precaricato TALTZ AUST R 253893

    Siringa preriempita TALTZ AUST R 253892

    In caso di domande su TALTZ, contattare Eli Lilly al 1800454 559 (Australia)
    o il tuo medico per l'assistenza.

    Questo foglio illustrativo è stato preparato nel marzo 2020.

    vA09

    Psorilax:Ridotto |crema per psoriasi senza cortisone

    0

    Psorilax: prezzo, funziona, recensioni, opinioni, ingredienti

    Nota dell'editore: queste informazioni sono fornite a scopo educativo. Non ha lo scopo di diagnosticare o trattare alcuna condizione. In caso di lesioni cutanee o problemi di salute, consultare di persona un operatore sanitario autorizzato.

    La psoriasi è complessa da trattare.

    In effetti, il medico Paul Bechet una volta disse che era “l'antidoto all'ego di un dermatologo” (1).

    È una malattia autoimmune che provoca dolore cronico e prurito che può avere un forte impatto sulla qualità della vita.

    Si dice che molti alimenti e integratori aiutino con il trattamento della psoriasi. Ma la ricerca supporta queste affermazioni?

    Questo articolo esamina le prove che circondano la relazione tra dieta e psoriasi.

    Che cos'è la psoriasi e i suoi sintomi?

    La psoriasi è una malattia autoimmune cronica che provoca infiammazione e squame di chiazze di pelle.

    Colpisce fino al 4% della popolazione mondiale (2).

    I sintomi si manifestano nei razzi e includono prurito, dolore e lesioni cutanee. La psoriasi può anche causare unghie e unghie dei piedi snocciolate, oltre a piaghe alla bocca.

    Esistono sei tipi di psoriasi. Ogni tipo provoca un'eruzione cutanea distintiva:

    • La psoriasi a placche provoca un'eruzione cutanea rossa alla base con squame d'argento sulla parte superiore. Rappresenta il 90% di tutti i casi di psoriasi (3).
    • La psoriasi guttata provoca gruppi di lesioni rosse a forma di goccia.
    • La psoriasi inversa colpisce i genitali e le ascelle e l'area sotto il seno. Provoca un'eruzione cutanea liscia e rossa che viene spesso aggravata dal calore e dall'attrito.
    • La psoriasi pustolosa è spesso innescata da fattori di stress ambientale. Causa vesciche piene di pus sulla pelle.
    • La psoriasi eritrodermica è una condizione medica potenzialmente grave caratterizzata da un'eruzione cutanea rossa e squamosa su tutto il corpo.
    • L'artrite psoriasica provoca lesioni cutanee, nonché dolori articolari e infiammazione.

    Psoriasi a placche Fonte immagine.

    Psoriasi guttata Fonte immagine.

    Psoriasi inversa Fonte immagine.

    Psoriasi pustolosa Fonte immagine.

    Psoriasi eritrodermica. Fonte immagine.

    Sommario: La psoriasi è una condizione cronica che provoca eruzioni cutanee, prurito, infiammazione e dolore distintivi. I sintomi si manifestano in razzi.

    Cause della psoriasi

    La psoriasi è causata da una combinazione di fattori genetici, ambientali e immunologici (3).

    Un ampio studio ha scoperto che il rischio di una persona aumenta fino al 65% se i genitori hanno la psoriasi e fino all'83% se sia i genitori che i fratelli lo hanno (4).

    Non tutti coloro che portano il gene svilupperanno la psoriasi. Tuttavia, l'esposizione a determinati stimoli ambientali può aumentare la probabilità che una persona sviluppi la malattia.

    Questi stimoli includono:

    • Stress emotivo (5).
    • Alcune infezioni, incluso mal di gola (6).
    • Alcuni farmaci, tra cui antiipertensivi, beta-bloccanti, antipsicotici, farmaci antimalarici e farmaci antinfiammatori non steroidei (7, 8, 9).
    • Fattori di stile di vita, tra cui obesità, consumo di alcol e fumo (10, 11, 12).

    In presenza di fattori ambientali e genetici, il sistema immunitario non funziona correttamente.

    Di conseguenza, le cellule T, che normalmente rispondono a infezioni e lesioni, vengono erroneamente attivate. Queste cellule reclutano altre cellule immunitarie e innescano il rilascio di citochine infiammatorie (13).

    Questo fa sì che le cellule della pelle muoiano e si rigenerino più rapidamente di quanto dovrebbero.

    Insorgenza della psoriasi. Fonte immagine. Clicca per ingrandire.

    Gli stessi fattori ambientali che causano la psoriasi possono anche portare a razzi, quindi è meglio limitare l'esposizione a loro quando possibile.

    Sommario: La psoriasi si verifica quando il sistema immunitario attacca erroneamente cellule della pelle sane. Molte persone portano un gene per la malattia e lo sviluppano dopo l'esposizione a determinati fattori ambientali.

    Dieta e trattamento della psoriasi

    I trattamenti standard per la psoriasi comprendono farmaci topici e orali, nonché la terapia con luce ultravioletta.

    Non ci sono prove scientifiche che la dieta sia un trattamento efficace per la psoriasi da sola.

    Tuttavia, testimonianze e studi di pazienti hanno dimostrato che alcune strategie dietetiche possono aiutare ad alleviare i sintomi della psoriasi, specialmente se associati a terapie tradizionali.

    Le sezioni seguenti si concentreranno su alimenti e sostanze nutritive che influenzano la gravità della psoriasi.

    Ottieni e mantieni un peso corporeo sano

    Il sovrappeso (in ambito clinico) è caratterizzato da un indice di massa corporea (BMI) maggiore di 24,9.

    Un BMI maggiore di 29.9 è classificato come obeso.

    Molti studi hanno trovato un possibile legame tra obesità e psoriasi.

    In uno studio a lungo termine su oltre 67.000 donne (14):

    • Le donne con un BMI del 25,0-29,9 avevano una probabilità fino al 21% in più di avere la psoriasi rispetto alle donne con un BMI sano.
    • Le donne con un BMI di 30,0-34,9 avevano una probabilità fino al 63% in più di avere la psoriasi rispetto alle donne con un BMI sano.
    • Le donne con un BMI superiore a 35 avevano fino al 103% in più di probabilità di avere la psoriasi rispetto alle donne con un BMI sano.

    Anche un aumento di peso di soli 4,5 kg sembra aumentare il rischio fino all'8%, indipendentemente dalla classificazione dell'IMC (15).

    Oltre al rischio, l'obesità è anche legata alla gravità della malattia. Ciò è probabilmente dovuto al fatto che un eccesso di tessuto adiposo aumenta la produzione di citochine infiammatorie, che contribuiscono all'infiammazione e alle lesioni nella psoriasi (16, 17).

    Ha senso quindi che gli studi abbiano dimostrato che la limitazione calorica associata ai farmaci è più efficace nel ridurre i sintomi della psoriasi rispetto ai soli farmaci (18).

    In particolare, la maggior parte degli studi sull'obesità e sulla psoriasi sono osservativi. Ciò significa che i ricercatori non sono esattamente sicuri se l'obesità causi la malattia o viceversa.

    In ogni caso, la psoriasi è collegata con molti altri fattori di rischio di malattie cardiache, tra cui colesterolo alto, diabete e ipertensione.

    La perdita di peso può ridurre il rischio di malattie cardiache per le persone in sovrappeso o obese, quindi ha senso mantenere un peso sano (17).

    Puoi calcolare il tuo indice di massa corporea qui.

    Sommario: Coloro che sono molto in sovrappeso hanno maggiori probabilità di avere la psoriasi, anche se i ricercatori non sono sicuri se l'obesità la causa direttamente. Mantenere un peso corporeo sano riduce anche il rischio di malattie cardiache che è più comune nei pazienti con psoriasi.

    Il protocollo autoimmune, glutine e alcol

    Il protocollo autoimmune (AIP) è una dieta che elimina glutine, soia, latticini, legumi, cereali, zuccheri aggiunti, ombretti e alcol per almeno 30 giorni.

    L'obiettivo è identificare gli alimenti che scatenano reazioni autoimmuni indesiderate.

    Esiste un forte legame tra la psoriasi e altre malattie autoimmuni. In un ampio studio, quelli con psoriasi avevano tassi più elevati di 14 diverse malattie autoimmuni rispetto alla popolazione generale (19).

    Le testimonianze dei pazienti suggeriscono che l'AIP è utile per molte condizioni, inclusa la psoriasi.

    Non ci sono stati studi clinici sull'AIP, quindi non ci sono prove scientifiche a supporto. Ma alcuni alimenti eliminati nell'AIP, inclusi glutine e alcool, sono stati segnalati per peggiorare i sintomi della psoriasi.

    Alcuni piccoli studi hanno dimostrato una dieta priva di glutine per migliorare i sintomi della psoriasi, ma solo in quelli con anticorpi contro la gliadina (una proteina presente nel glutine). Questi anticorpi sarebbero stati osservati in soggetti con celiachia o sensibilità al glutine non celiaca (20).

    Anche se altri studi non hanno riscontrato alcun beneficio, quindi non è affatto chiaro in questa fase (19).

    È stato suggerito un legame più forte tra l'assunzione di alcol e la gravità della psoriasi.

    Una revisione di 28 studi ha scoperto che l'alcol è probabilmente un fattore di rischio per lo sviluppo della psoriasi e che quelli con la malattia bevono più degli adulti sani (11).

    È meglio evitare l'alcol se si ha la psoriasi o una forte storia familiare.

    Sommario: Le testimonianze dei pazienti suggeriscono che il protocollo autoimmune può aiutare con la psoriasi, ma questo non è stato studiato formalmente. Dovresti assolutamente evitare l'alcol e potenzialmente anche il glutine se sei sensibile.

    Diete antinfiammatorie e mediterranee

    Una dieta occidentale ricca di grassi, sodio e zuccheri aggiunti è stata collegata all'infiammazione e alla malattia autoimmune (21).

    Per questo motivo una cosiddetta dieta antinfiammatoria può alleviare i sintomi della psoriasi.

    Non esiste una definizione universale per la dieta anti-infiammatoria, ma generalmente si riferisce a uno stile di alimentazione che (22, 23, 24):

    • è moderato in calorie.
    • ha un rapporto favorevole tra acidi grassi omega-3 e omega-6.
    • identifica ed elimina gli alimenti che causano sensibilità.
    • limita le carni rosse e trasformate.
    • riduce lo zucchero aggiunto.
    • enfatizza frutta, verdura e cereali integrali.
    • elimina i grassi trans.

    Una dieta anti-infiammatoria non è stata studiata specificamente nella psoriasi, ma l'infiammazione sistemica è una caratteristica chiave della malattia.

    Questo modello di dieta ha anche dimostrato di aiutare con alcune malattie autoimmuni, quindi in teoria e sulla base delle testimonianze dei pazienti può essere utile (18, 25, 26).

    Le testimonianze dei pazienti indicano anche che un modello alimentare antinfiammatorio è utile per l'artrite. Come tale, può essere utile per alleviare il dolore e la rigidità in quelli con artrite psoriasica (27, 28).

    La dieta è simile in molti modi alla dieta mediterranea, che comprende pesce e carni magre, verdure, frutta, grassi sani, cereali integrali e legumi.

    In uno studio, una maggiore aderenza alla dieta mediterranea è stata associata a un minor numero di sintomi della psoriasi. Inoltre, quelli con meno sintomi hanno mangiato più frutta, verdura, legumi, noci e pesce e meno carne (29).

    Sono necessari ulteriori studi sull'uomo per sapere se la dieta mediterranea è benefica per la psoriasi. Ma dati i suoi altri benefici per la salute, come la riduzione del rischio di malattie cardiache, ha senso mangiare in questo modo indipendentemente dai suoi effetti sulla pelle (30).

    Sommario: Le diete anti-infiammatorie e mediterranee enfatizzano grassi sani, frutta, verdura e cereali integrali. Uno studio ha collegato la dieta mediterranea a sintomi della psoriasi migliorati.

    Supplementi per la psoriasi

    Diversi integratori alimentari sono stati segnalati per aiutare con il trattamento della psoriasi.

    Olio di pesce

    Le capsule di olio di pesce contengono gli acidi grassi omega-3 acido eicosapentaenoico (EPA) e acido docosaesaanoico (DHA).

    È noto per le sue proprietà anti-infiammatorie.

    In una revisione della letteratura, 12 studi su 15 hanno scoperto che l'olio di pesce migliora la gravità della psoriasi (31).

    L'evidenza più forte è a sostegno delle infusioni omega-3 endovenose (IV) ad alte dosi per la psoriasi a placche e guttate. Tuttavia, questa non è una terapia tipica e non sarebbe prontamente disponibile per la maggior parte dei pazienti (32, 33).

    Un piccolo studio osservazionale ha scoperto che i supplementi di olio di pesce per via orale hanno ridotto significativamente la gravità della psoriasi e migliorato la qualità della vita se abbinati a unguento per prescrizione. I volontari in questo studio hanno ricevuto 640 mg di DHA più EPA al giorno per otto settimane (34).

    Variazione dell'area della psoriasi e dell'indice di gravità (PASI) sopra durata di studio per olio di pesce più gruppo unguento rispetto al gruppo solo unguento. Inferiore il punteggio è migliore. Clicca per ingrandire.

    Sono necessari studi clinici più ampi per confermare questi effetti ma sembra promettente.

    Probiotici

    I probiotici sono batteri benefici che mangiamo.

    Recentemente sono stati al centro di numerosi studi a causa dell'interazione tra il microbioma intestinale e varie condizioni di salute, inclusa la psoriasi.

    Uno studio ha scoperto che gli adulti con psoriasi, in particolare l'artrite psoriasica, hanno meno diversità nei batteri intestinali rispetto agli adulti sani. I ricercatori hanno paragonato il profilo batterico nella psoriasi a quello della malattia infiammatoria intestinale, che spesso risponde bene ai probiotici (35, 36).

    In un altro studio, 23 pazienti con psoriasi a placche da lieve a moderata hanno ricevuto il probiotico Bifidobacterium infantis 35264 alla dose di 1 × 1010 unità formanti colonia (CFU) al giorno per otto settimane.

    I ricercatori hanno scoperto che la maggior parte dei marker di infiammazione del sangue (CRP e TNF-a) erano significativamente più bassi a otto settimane (37).

    Altri ceppi di probiotici non sono ancora stati studiati specificamente nella psoriasi.

    Vitamina D

    La vitamina D aiuta a regolare il sistema immunitario inibendo la moltiplicazione delle cellule T e limitando la produzione di citochine (38).

    Poiché le cellule T e le citochine svolgono un ruolo chiave nella psoriasi e poiché la carenza di vitamina D è comune tra le persone con malattia autoimmune, è stata studiata come possibile terapia per la psoriasi (38).

    Una revisione della letteratura ha scoperto che gli integratori e gli unguenti di vitamina D sono efficaci quanto i corticosteroidi per alleviare i sintomi. I benefici erano ancora maggiori quando la vitamina D veniva usata con un unguento steroideo ad alte dosi (39).

    In uno studio, 85 pazienti con psoriasi hanno iniziato a prendere 0,5 microgrammi (μg) di calcitriolo orale (la forma attiva di vitamina D3) al giorno. I ricercatori hanno aumentato la dose giornaliera di 0,5 μg ogni due settimane, a condizione che i test di laboratorio fossero normali. I volontari hanno ricevuto cure per 6-36 mesi.

    I pazienti hanno visto riduzioni significative dei punteggi PASI (Psoriasis Area and Severity Index) a sei mesi e miglioramenti ancora maggiori a 24 mesi. Quasi il 27% ha avuto un completo miglioramento dei sintomi, mentre l'88% ha avuto un certo miglioramento (31, 40).

    I risultati sono promettenti e non sono stati segnalati effetti collaterali negativi.

    Ma sono necessari studi clinici di alta qualità per trarre conclusioni definitive.

    antiossidanti

    Gli antiossidanti sono molecole che proteggono le cellule dallo stress ossidativo.

    Una manciata di studi hanno collegato lo stress ossidativo e la psoriasi e alcuni antiossidanti sono stati proposti come terapia supplementare per la malattia (41, 42).

    Selenio

    Il selenio è un minerale antiossidante presente in verdure, carne, pesce, pollame, cereali e uova.

    Le prove sono contrastanti sul fatto che la carenza di selenio contribuisca direttamente al rischio di psoriasi (43, 44).

    Piccoli studi, tuttavia, hanno scoperto che potrebbe svolgere un ruolo indiretto. Il selenio aiuta a inibire l'attività di una proteina chiamata osteopontin e si pensa che alti livelli di osteopontin aumentino il rischio di psoriasi (45, 46).

    Non è chiaro se gli integratori di selenio siano utili nel ridurre i sintomi.

    In uno studio condotto su 58 pazienti affetti da psoriasi, l'integrazione con 48 μg di selenio al giorno ha ridotto la gravità dei sintomi più rapidamente e in modo più significativo rispetto al placebo. Sfortunatamente, è difficile sapere quale ruolo abbia avuto il selenio nel miglioramento, poiché le capsule includevano anche il coenzima Q10 e la vitamina E (47).

    Altri studi hanno dimostrato che gli integratori di selenio sono uguali o inferiori al placebo, quindi non è chiaro se siano utili (48, 49).

    La curcumina

    La curcumina è il principale composto chimico nella curcuma delle spezie.

    Si dice che abbia forti proprietà anti-infiammatorie e le testimonianze dei pazienti suggeriscono che è utile nella psoriasi.

    Tuttavia, studi sui roditori e piccoli studi sull'uomo hanno trovato risultati contrastanti in termini di miglioramento dei sintomi (50, 51).

    Inoltre, una recente revisione ha avvertito che i benefici della curcumina potrebbero essere sopravvalutati. In effetti, i ricercatori hanno sollevato preoccupazioni sul fatto che il composto possa mascherare l'infiammazione piuttosto che trattarla (52).

    In breve, non ci sono attualmente prove evidenti a sostegno della curcumina per la psoriasi.

    La quercetina

    La quercetina è un antiossidante flavonoide che si trova in molti frutti e verdure.

    Uno studio condotto su topi ha scoperto che da 25 a 50 grammi di quercetina per chilogrammo di peso corporeo hanno ridotto significativamente lo spessore e l'infiammazione della pelle e aumentato la produzione di cellule della pelle sane (53).

    Tuttavia, non è noto come la quercetina influenzi l'attività della psoriasi nell'uomo. In effetti, recenti studi sull'uomo hanno messo in dubbio il potere antiossidante dei flavonoidi alimentari in generale.

    La quercetina e altri flavonoidi sono scarsamente assorbiti, il che indica che altri fattori possono contribuire alla sua azione antiossidante (54).

    In questa fase sembra che la quercetina non aiuti con la psoriasi.

    Parla sempre con il tuo medico prima di iniziare qualsiasi supplemento.

    Sommario: Dei molti integratori che possono aiutare con la psoriasi, l'olio di pesce, i probiotici e la vitamina D mostrano la più promettente. Sono generalmente considerati sicuri, ma dovresti sempre parlare con il tuo medico prima di iniziare gli integratori.

    Trattamento della psoriasi: The Punch Line

    Nessuna dieta o pillola può curare la psoriasi.

    Tuttavia, alcuni schemi alimentari e integratori sono stati segnalati per alleviare i sintomi.

    La ricerca mostra che è importante raggiungere e mantenere un peso corporeo sano, in quanto il sovrappeso o l'obesità sono associati a un maggior rischio di psoriasi e una maggiore gravità dei sintomi.

    Le testimonianze dei pazienti indicano che il protocollo autoimmune (AIP) può aiutare, ma non è stato studiato formalmente. Alcune linee guida dell'AIP sono comunque utili, come evitare il glutine se si è sensibili ed eliminare le bevande alcoliche.

    In alternativa, una dieta anti-infiammatoria come la dieta mediterranea ha mostrato risultati promettenti nel ridurre la gravità della malattia. Questo modello alimentare ha molti altri benefici noti ed è fortemente raccomandato.

    Alcune prove suggeriscono che l'olio di pesce supplementare, la vitamina D e un particolare ceppo probiotico aiutano anche a ridurre i sintomi. Sono necessari studi più efficaci, ma questi integratori sono generalmente ben tollerati.

    Chiedi sempre al tuo medico prima di iniziare qualsiasi nuovo integratore.

    __

    Questo articolo è originariamente apparso su Diet vs. Disease ed è stato ripubblicato qui con il permesso dell'autore.


    bottom of post widget GMP community logo (1)

    Vuoi far parte della creazione di una società più gentile e inclusiva?

    Psorilax:Acquista con paypal |crema attiva just psoriasi

    0

    Psorilax: prezzo, funziona, recensioni, opinioni, quanto costa

    C'è un anno bianco nella memoria un tempo immacolata della venticinquenne Caroline Walsh.

    Ha messo insieme parti di storie raccontate dai suoi amici e una raccolta di foto su Facebook. Ma non ricorda il giorno in cui tutto ebbe inizio, quando suo padre la trovò nel mezzo di un attacco, il suo corpo che si contorceva sul pavimento. Inoltre non ricorda di essersi svegliata con le mani legate a un letto d'ospedale, di aver supplicato sua sorella di aiutarla a fuggire, o il giorno dopo quando ha proclamato di essere la Zac Brown Band.

    Invece, il primo ricordo di Walsh di quel tempo è di una stanza di recupero piena di famiglia e fiori. A quel punto, i suoi medici le avevano diagnosticato una misteriosa malattia chiamata encefalite autoimmune, o in breve AE. Sebbene ci siano molte cose che ancora non conosciamo della condizione, gli esperti ritengono che faccia parte di una classe più ampia di malattie in cui il corpo si trasforma in se stesso.

    Nel caso di Walsh, la malattia ha attaccato il suo cervello, scatenando una reazione a catena di sintomi che imitavano quelli di altre malattie mentali come la depressione e la schizofrenia. Se trattati correttamente e abbastanza presto, le persone con AE possono effettuare un recupero quasi completo. Ma se non vengono diagnosticati o atterrano in un reparto psichiatrico, possono morire.

    Una passeggiata lungo una vera strada chiamata Memory Lane a Londra ti porta al London Institute of Psychiatry, dove J.A.N. “Nick” Corsellis affondò nel cervello di tre cadaveri e trovò le prime prove di AE.

    Nel profondo della parte densa del cervello chiamata sistema limbico, la rete normalmente elastica di tessuto liscio e gommoso era diventata gonfia e infiammata. Era come se qualcosa l'avesse attaccato dall'interno.

    Alla maggior parte delle persone a cui apparteneva un tempo il cervello era stato diagnosticato un cancro, quindi sembravano riprendersi completamente. Ma le loro personalità hanno iniziato a cambiare. Un partner o un amico di solito è stato il primo a notare uno strano cambiamento nel loro comportamento – di solito un progressivo aumento dell'oblio, sebbene altri abbiano sperimentato un improvviso attacco di mania o depressione. Un autista di autobus di 58 anni si è ritrovato a svegliarsi quasi tutti i giorni senza sapere dove fosse.

    Corsellis vide un'infiammazione in alcune parti del cervello legata alla memoria e all'umore, ma non riuscì a spiegare cosa avesse causato il gonfiore che aveva scatenato i sintomi.

    “La prima domanda che si pone … è se l'affermazione di una connessione tra carcinoma (cancro) ed” encefalite limbica “sia ora giustificata, anche se non può essere spiegata”, ha scritto in un articolo del 1968 sulla rivista Brain. era la prima volta che la condizione veniva menzionata in una rivista scientifica.

    I sintomi di Walsh sono diventati evidenti un giorno al lavoro quando ha iniziato a ripetersi. Ha scherzato con un collega che stava arrivando con l'Alzheimer ad esordio precoce.

    “Ero sempre molto confuso tutto il tempo”, dice Walsh.

    La settimana successiva sono sorti problemi più misteriosi: Walsh ha avuto un talento per ricordare i nomi, ma un giorno quando ha incontrato alcuni nuovi amici, si è presentata una mezza dozzina di volte e ha lottato per affidare il nome di qualcuno alla memoria.

    “Lo dicevano e poi un paio di minuti dopo non avevo idea di come si chiamassero o di cosa stessimo parlando”, dice.

    In ufficio il giorno dopo, le cose peggiorarono. “La mia personalità era appena fuori. Ho pensato che funzionasse. Ho messo da parte il mio capo in una sala conferenze e ho iniziato a piangere, che non ero proprio io”, dice. Quando non si sentiva stressata e ansiosa, si sentiva depressa.

    “Qualcosa stava solo producendo, lo sentivo”, dice.

    Quando il corpo attacca se stesso

    Il nostro sistema immunitario è la difesa del nostro corpo contro il mondo esterno.

    La maggior parte dell'azione è coordinata da globuli bianchi, che dirigono le linee di attacco come allenatori di calcio, sfornando anticorpi che colpiscono l'avversario per la distruzione.

    globuli bianchi Ma a volte il processo può andare storto. Nel generare una risposta immunitaria contro un virus o altre malattie, il corpo può finire per attaccare se stesso – una classe più ampia di malattie note come malattie autoimmuni.

    È come se “alcuni fili si incrociano”, afferma Brenden Kelley, neuroradiologo all'ospedale Henry Ford di Detroit, che fa parte della piccola comunità che ricerca l'encefalite autoimmune.

    A volte, questa risposta anormale può essere causata da un virus come l'influenza o un'infezione batterica. Altre volte, alcuni tipi di cancro sembrano essere la fonte.

    “Nel selezionare bersagli che corrispondono al cancro, il corpo può anche scegliere bersagli che corrispondono a luoghi nel tuo corpo che non hanno il cancro”, afferma Kelley.

    Tre mesi dopo, Walsh si trasferì nella sua casa d'infanzia fuori Boston, e vide due dottori che le avevano diagnosticato erroneamente l'influenza.

    Poi una mattina intorno alle 4 del mattino, mentre suo padre, un agente di polizia di Boston, si preparava al lavoro, sentì un forte incidente. Trovò sua figlia a terra, con gli arti che le battevano. Ha urlato il suo nome, ma lei non ha risposto.

    La causa più comune del tipo di attacco che Walsh ha avuto quel giorno – noto come un grande attacco (letteralmente “grande malattia” in francese) – è l'epilessia. Altre cause possono includere glicemia estremamente bassa, febbre alta e ictus.

    All'ospedale, i medici di Walsh l'hanno testata ampiamente, facendo più punture lombari o “colpi alla colonna vertebrale”, una procedura dolorosa e pericolosa che prevede la raccolta e l'analisi del fluido protettivo che circonda il suo cervello e il midollo spinale. Nella maggior parte dei casi, è qui che i medici individuano per la prima volta l'encefalite autoimmune, afferma Kelley.

    Ma a volte, come nel caso di Walsh, i segni caratteristici dell'infiammazione sono troppo sottili per trarre una conclusione definitiva.

    caroline walsh 1

    Caroline all'ospedale.

    Caroline Walsh

    Quando la sorella di Caroline, Alana, arrivò all'ospedale, Caroline giaceva immobile sul suo letto d'ospedale sotto l'illuminazione dura. Le sue mani erano state racchiuse in guanti fortemente imbottiti che sembravano guantoni da boxe e erano fissate alle ringhiere sul suo letto per impedirle di estrarre i tubi endovenosi mantenendola idratata. Chiese ad Alana di avvicinarsi per poterle sussurrare qualcosa all'orecchio.

    “Devi combatterli, devi portarmi fuori di qui,” disse Caroline, facendo cenno con la testa alle infermiere mentre le guardava sospettosamente.

    Quando Alana chiese a sua sorella di cosa stesse parlando, Caroline spiegò che era stata rapita mentre dormiva e ora era tenuta in ostaggio in ospedale.

    Poche ore dopo, dopo essersi trasferita nello stato assonnato e stordito in cui si trovava per gran parte della sua degenza in ospedale, si svegliò di scatto e proclamò di essere la cantante country della Zac Brown Band. Ha iniziato a cantare la sua canzone preferita, una melodia orecchiabile di prendersi una pausa dalla realtà chiamata “Knee Deep”.

    “Metterò via il mondo per un minuto” cantava, diventando più forte ad ogni verso. “Fai finta che non ci viva.”

    Quando la sua famiglia non riuscì a fermare il pianto di Caroline, Alana si alzò e chiuse le porte della sua stanza nel tentativo di impedirle di svegliare tutti nel reparto. Caroline continuò.

    “Mente per una vacanza permanente, tL'oceano è la mia unica cura, wla mia condizione non andrà mai via. “

    Durante la settimana successiva, Walsh ha proceduto al sequestro più di cento volte. Alana ricorda che quasi ogni volta che si sedeva per parlare con lei, Caroline lo afferrava una mezza dozzina di volte. Non erano convulsioni enormi come quella che l'aveva portata in ospedale, ma piccole, appena percettibili.

    “Lo sapresti perché i suoi occhi si allontanerebbero e fisserebbe in un punto, ne aveva di piccoli quasi ogni minuto”, dice Alana. “Era molto traballante e confusa; il suo battito cardiaco era estremamente alto, e i dottori sembravano così confusi da tutto ogni volta che abbiamo parlato con loro, erano come se non potesse andare in questi attacchi tutto il tempo, è anche troppo tanto.”

    Alla fine, i medici hanno deciso di metterla in coma indotto dal medico.

    Nei bambini, infezioni come mal di gola sembrano essere un fattore scatenante di AE. Susan Schulman, una pediatra di New York, afferma di aver visto centinaia di casi di una condizione correlata, chiamata PANS (sindrome neuropsichiatrica pediatrica ad esordio acuto), nei suoi pazienti. Il suo primo caso, nel 1998, fu una bambina di cinque anni di Brooklyn che fu presa dal panico per tenere separati gli abiti che indossava durante le vacanze ebraiche di Shabbat dai suoi abiti normali.

    “Stava facendo impazzire sua madre”, dice Schulman. Inizialmente, credeva che la ragazza avesse un disturbo ossessivo-compulsivo durante l'infanzia, ma i farmaci peggioravano i sintomi del bambino e tornò nell'ufficio di Schulman con sintomi di DOC più intensi e un brutto caso di mal di gola. Stranamente, dopo che Schulman ha trattato lo streptococco con antibiotici, i sintomi del DOC sono svaniti.

    “Ho detto che sai cosa, è strano”, dice Schulman.

    caroline walsh 3


    Caroline Walsh

    Nello stesso periodo, un pediatra dell'NIH di nome Susan Swedo pubblicò un articolo sull'American Journal of Psychiatry che descriveva 50 casi di un fenomeno che lei chiamava “disturbi neuropsichiatrici autoimmuni pediatrici associati a infezioni da streptococco”. Schulman si rese conto che gli improvvisi sintomi psichiatrici che aveva osservato nei suoi giovani pazienti – che andavano dal DOC alla rabbia e alla paranoia – erano probabilmente collegati alle loro infezioni.

    “Vedo l'infezione come il fiammifero che accende la reazione autoimmune. L'infiammazione è il fuoco; i sintomi che vedi sono il fumo che esce dal fuoco”, dice Schulman.

    Le condizioni autoimmuni che colpiscono il cervello rappresentano solo una frazione di tutte le malattie autoimmuni. Gli scienziati hanno identificato ben altri 80, che vanno dal diabete di tipo 1, che si sviluppa quando il corpo attacca le sue cellule che producono insulina, alla sclerosi multipla, alla psoriasi e all'artrite reumatoide. Altri vengono riconosciuti ogni anno.

    Kelley e altri alla Henry Ford stanno attualmente ricercando malattie autoimmuni che colpiscono il cervello. Lavorando con scienziati specializzati nel cervello e nel sistema immunitario, Kelley spera di scoprire cosa hanno in comune queste condizioni in modo che il team alla fine riesca a capire quali sono le cause.

    “Molte di queste condizioni sono varianti sullo stesso tema”, afferma.

    Nel caso di Walsh, “queste sono persone che tendono a non avere molti altri problemi di salute e poi all'improvviso si sentono come impazziti, si stanno perdendo”, dice Kelley. “Tende ad essere molto chiaro che qualcosa non va, ma proprio quello che sta succedendo può essere difficile da mettere insieme.”

    Quando Walsh si svegliò nella sua stanza d'ospedale, non era sicura del perché fosse lì.

    “Ero tipo perché tutte queste persone sono nella mia stanza? Perché è decorato con tutti questi fiori?”, Ricorda.

    Circa un giorno prima, uno specialista aveva diagnosticato a Walsh l'encefalite autoimmune e l'aveva iniziata con un regime di potenti steroidi, ora considerato uno dei migliori trattamenti per la malattia. I farmaci hanno iniziato a ridurre l'infiammazione nel suo cervello. Nel caso di Walsh, l'area interessata era il suo ippocampo, la regione responsabile della creazione e della memorizzazione dei ricordi.

    “Ricordo solo che continuavo a chiedere” Cosa? ” sai “Aspetta, perché sono qui?” e me lo dicevano, ma io continuavo a dimenticare “, dice.

    caroline walsh 4

    Caroline all'ospedale di riabilitazione di Spaulding.

    Caroline Walsh

    Nei pazienti la cui encefalite autoimmune sembra essere scatenata dal cancro (al contrario di Walsh, che potrebbe essere stato scatenato dall'influenza), il trattamento si concentra sul trattamento o sulla rimozione del tumore per primo. “Quando rimuovi il cancro, rimuovi lo stimolo”, dice Kelley.

    Il trattamento per l'encefalite autoimmune può variare in base al fattore scatenante, ma il tempismo è sempre fondamentale. Se i medici trattano qualunque cosa scateni la condizione, molte persone con la malattia possono continuare a condurre una vita abbastanza normale e piena.

    “In un certo senso è una corsa contro il tempo”, afferma Kelley.

    Quando Walsh iniziò a riacquistare la sua capacità di ricordare, si rese conto che avrebbe dovuto imparare di nuovo molte cose di base.

    “Ricordo di essermi alzato per usare il bagno, e una delle infermiere è andata a portarmi una sedia a rotelle ed ero tipo 'Oh no, non ne ho bisogno'”, dice Walsh. “Quindi ho pensato di alzarmi in piedi e all'improvviso non avevo idea, non riuscivo a camminare.”

    Ha riacquistato queste abilità nei successivi 10 giorni allo Spaulding Rehabilitation Center, nello stesso posto in cui i sopravvissuti all'attentato alla maratona di Boston furono portati dopo l'attacco. Lì, Walsh ha imparato di nuovo come mettere un piede davanti all'altro e come tenere un cucchiaio.

    Walsh ora lavora part-time come tata e volontari con Spaulding e il Boston Boys and Girls Club. Invece di tornare alle vendite, ha in programma di lavorare con i bambini in qualche modo. Di recente ha partecipato a un evento di raccolta fondi Spaulding con sua sorella, Alana, dove si è imbattuta nel fisioterapista che l'ha aiutata a camminare in linea retta per la prima volta.

    “Eravamo nei nostri vestiti e stavamo entrambi ballando insieme”, dice Walsh, “e Alana era tipo, 'Sai che ti ha insegnato a camminare di nuovo?'”