CREMA TRATTAMENTO PSORIASI OFFERTA -50% !

Home Blog Page 243

Psorilax:Il modo migliore per |crema per assottigliare la pelle da psoriasi

0

Psorilax: prezzo, funziona, recensioni, opinioni, composizione

Psorilax:Evitare |crema zolfo per psoriasi

0

Psorilax: prezzo, funziona, recensioni, opinioni, dove si compra

Una crema idratante facilmente reperibile in negozi come Boots e Asda viene descritta da persone che la usano come una “cura miracolosa” per il trattamento dell'eczema e della psoriasi.

Una mamma, che ha trascorso 20 anni indossando collant spessi per nascondere una grave condizione della pelle, dice che sta andando a gambe nude per la prima volta dopo averlo usato.

Kirsty Usher dice che era così imbarazzata per la psoriasi, che appariva principalmente sulle sue gambe, che indossava i collant da quando aveva vent'anni.

Le persone si sono rivolte a Facebook per segnalare gli effetti della crema. Una madre ha detto che ha avuto un effetto drammatico sulla sua giovane figlia, mentre un'altra donna ha detto che si era sbarazzata della psoriasi di cui aveva sofferto per anni.

Ma altri hanno detto che la crema non ha avuto effetti. È necessario controllare l'etichetta prima dell'uso e consultare un medico in caso di dubbi.



Kirsty Usher

La crema, Childs Farm Baby Moisturizer, non è prodotta da una gigantesca azienda farmaceutica. Costa £ 3,99.

Kirsty ha detto: “Negli ultimi 20 anni sono stata così imbarazzata per le mie gambe che ho indossato collant 100 denari, anche in piena estate.

“Il peggio della mia psoriasi è sempre stato sulle gambe, ma anche sui gomiti e sul cuoio capelluto.

“Posso dire alle persone che pensano che sia contagioso dagli sguardi che mi danno, quindi ho sempre pensato che fosse più facile coprirsi piuttosto che essere messo a disagio dalle persone che lo fissavano.

“Una sera sono uscito con i miei amici e mi hanno convinto a lasciare i collant a casa. Al bar, un uomo è venuto da noi e mi ha preso in giro per le mie gambe. Era così – non sono mai uscito senza i miei collant. dopo di che.

“Quando ho visto la storia della crema idratante per neonati Childs Farm ho pensato: 'perché no?' Ero disperato che qualcosa funzionasse.

“Sono entrato in Tesco per comprare la crema e ho iniziato a usarla, e nel giro di un paio d'ore il prurito era cessato. Entro una settimana ho potuto vedere che la mia pelle non era più così rossa, e subito dopo la mia pelle era davvero piatta e potevo vedere intere sezioni in cui le mie gambe erano di un colore della pelle piuttosto che di un rosso vivo.

“Questa è la prima volta in quasi 20 anni che indosso un vestito senza collant. È incredibile”.



Le gambe di Kirsty erano così a causa della psoriasi di cui ha sofferto a lungo



Ma dice che la condizione si è risolta drasticamente da quando ha iniziato a usare la crema idratante

Kirsty ha sviluppato per la prima volta la condizione all'età di 27 anni, apparentemente dall'oggi al domani, riporta Bristol Live.

Ha detto: “Mi sono appena svegliata una mattina coperta da quello che sembrava morbillo. Avevo minuscole macchie rosa su tutto il corpo”.

Le è stata diagnosticata la psoriasi circa sei mesi dopo e quando è peggiorata si è riferita all'ospedale per un trattamento regolare.

“Nel peggiore dei casi mi sembra che le mie gambe stiano andando a fuoco e si stiano spaccando e sanguinando”, dice.

“Togliermi i collant a volte è un'agonia perché le mie gambe si attaccano a loro. A volte fare la doccia o il bagno è come se mi venisse versato dell'acido sulle gambe. È un'agonia totale”.



La crema idratante per neonati Childs Farm che è stata elogiata dalle persone che l'hanno usata, che affermano che sta avendo effetti drammatici sulle loro condizioni della pelle

La mamma Paige Sweeney, 23 anni, ha utilizzato il prodotto sulla figlia di tre anni Evie-Rae e ha condiviso i risultati su Facebook.

Ha detto che innumerevoli appuntamenti con un dermatologo e una serie di farmaci diversi non sono riusciti a risolvere l'eczema di Evie-Rae, ma l'uso della crema idratante ha visto un rapido miglioramento.

Paige ha detto: “Ho provato di tutto nel tentativo di aiutare Evie-Rae. Ha avuto l'eczema da quando è nata, poi quando aveva cinque settimane le è stata diagnosticata un'allergia al latte.

“Il suo eczema era così doloroso che non ha dormito tutta la notte fino all'età di due anni. Si grattava e sanguinava costantemente “.

Prese una bottiglia di crema idratante da Boots per vedere se avrebbe fatto la differenza. Ha detto: “Ho visto la crema idratante sullo scaffale di Boots e ho deciso di provarci.

“Nel giro di pochi giorni ho potuto vedere la sua pelle iniziare a schiarirsi. Non ci potevo credere. Il NHS potrebbe risparmiare una fortuna se lo prescrivessero “.

La reazione inaspettata ha spinto Paige a postare su Facebook e il post è stato condiviso più di 40.000 volte, riferisce Chronicle Live.

Un'altra donna ha visto il suo post diventare virale quando ha descritto gli effetti della crema. Laura Grey ha detto: “Avevo bisogno di condividere questo con tutti voi. Soffro di psoriasi, l'ho fatto per anni. Ho sollevato tutto su braccia, collo e petto e fino a ieri solo la crema di idrocortisone se ne sbarazzava.

“Ma è davvero duro e solo i farmacisti possono dartelo. Ieri mia mamma mi ha detto di provare questa crema idratante per bambini, non sto scherzando, 24 ore dopo la mia psoriasi è sparita!”

Di conseguenza, la fondatrice di Childs Farm Joanna Jensen, che ha lanciato l'azienda nel 2010 a causa dei capelli fini e della pelle sensibile delle sue figlie, si è messa in contatto e ha fatto visita a Paige ed Evie-Rae.

Joanna ha detto: “La storia di Paige ed Evie-Rae non è insolita per noi, ma hanno dimostrato come un piccolo cambiamento possa fare la differenza.

“Da quando Paige ha condiviso le sue foto su Facebook, le vendite di creme idratanti sono salite alle stelle, volando via dagli scaffali al ritmo di una bottiglia al minuto.

“Siamo una piccola azienda rurale nell'Hampshire, che compete in uno spazio dominato dalle aziende farmaceutiche globali.

“Siamo costantemente sopraffatti dall'amore e dal sostegno che riceviamo per il nostro marchio dai genitori e dai loro figli, e tutto perché volevo rendere il momento del bagnetto più divertente e meno pruriginoso per le mie stesse ragazze!”

La crema è disponibile su asda.com o boots.com.

Psorilax:Studio |psoriasi topialyse creme

0

Psorilax: prezzo, funziona, recensioni, opinioni, originale

Introduction

Psoriasis is a chronically relapsing inflammatory disease of the skin affecting about 2% of the population worldwide.

Histologically, psoriasis is characterized by three principal features: epidermal hyperplasia, leukocyte infiltrate, and an increased number of tortuous and leaky vessels in the dermis (1–3). In recent studies, the presence of lymphoid aggregates/memory T cell clusters in the dermis of psoriatic plaques has been reported (4, 5).

20–30% of patients with psoriasis also develops psoriatic arthritis (PsA) and there is evidence that psoriasis is associated with systemic inflammation and with comorbidities, such as cardiovascular disease (6–12).

With regards to the pathogenesis, it is now emerging that psoriasis is an immune-mediated disease with a central autoimmune component mediated by T cells. Specifically, the disease pathogenesis involves a dynamic interplay between dermal dendritic cells, T cells (CD8+ autoreactive T cells, Th1, and Th17) and keratinocytes giving rise to a self-sustaining inflammatory cycle that develops around the TNF/IL-23/IL-17A axis (13–17). Despite this evidence, the hierarchical sequence of T cell-mediated events in the psoriatic inflammatory cascade is not completely defined. On the basis of the current literature and results of cytokine-blocking therapies it is possible to distinguish, in the T cell-mediated psoriatic inflammatory cascade, (i) an initial skin T cell activation phase, (ii) the establishment of chronic inflammation, (iii) the maintenance of clinically established lesions, and (iv) the egress from the skin of specific subsets of T cells that could possibly take part in the development of extra-cutaneous manifestations of psoriasis, including joint inflammation and cardiovascular comorbidities (18, 19).

T Cell Hierarchy in the Formation of Psoriatic Plaques

T cell responses against self-antigens in psoriasis are initiated by dendritic cells in the dermis of pre-psoriatic skin (20). Mature dermal dendritic cells can produce TNFα and IL-23, present self-antigens, and stimulate the activation of autoreactive CD8+ T cells together with a fraction of CD4+ T cells polarized toward Th17 phenotype or the IL-17+IFNγ+ pathogenic Th1/Th17 as described by Annunziato and co-workers and Eisdmo and co-workers (20–23).

Activated T cells can migrate to the epidermis and recognize epidermal autoantigens and possibly progress toward differentiation to tissue-resident memory T cells (TRM) characterized by CD69+CD103+CCR7CD45RACD62L phenotype (24, 25). Recognition of epidermal autoantigens by Tc1/Tc17 induces the secretion of cytokines, including IL-22, that mediate the initial phase of epidermal hyperproliferation and activation of keratinocytes (Figure 1A). These will produce chemokines and antimicrobial peptides, which lead to the progression of the inflammatory process (26–29).


www.frontiersin.org

Figure 1. T cell-mediated events in the psoriatic inflammatory cascade. (A) Activation of autoreactive T cells by self-antigens presented in the dermal lymphoid aggregates. Establishment of CD8+ TRM cells as central autoimmune component of disease pathogenesis and potential mechanisms of site-specific disease memory. (B) Polyclonal T cells proliferation and Th17/Tc17-mediated inflammation around the IL-23/IL-17A axis. (C) Recruitment of Th1/Tc1 cells, with multiple specificities, from the blood stream, induced by CXCL10 chemokines. Recirculation of T cells from the skin to the blood can spread inflammation at systemic level and at distant sites.

Epidermal autoantigens include LL-37 antimicrobial peptide expressed by keratinocytes, keratin 17, and melanocyte-derived antigen ADAMTS-like protein 5 (ADAMTSL5) recognized by IL-17A-producing CD8+ T cells, restricted by HLA-C*06:02 (26, 30–35).

This evidence together with early studies strongly supports that CD8+ T cells represent the autoimmune core of the disease. In psoriatic skin lesions, CD8+ T cells accumulate in the form of TRM with a pathogenic IFNγ–IL-17A cytokine profile that were detected also in resolved psoriatic lesions and identified as potential mechanisms of site-specific disease memory (20, 25, 36–42).

The major role of CD8+ T cells is also strongly supported by the fact that the main psoriasis risk gene is the HLA-class I allele HLA-C*06:02 on psoriasis susceptibility locus 1 on chomosome 6 and additional HLA-class I alleles are associated with psoriasis (43, 44).

Among tissue-resident T cells in human psoriatic skin, Clark and co-workers have recently shown that the vast majority has an αβ TCR (42), despite γδ T cells have been reported to play a role in the production of IL-17A and maintenance of inflammation (45, 46).

As regards to the TCR repertoire, studies of TCRBV chain sequencing showed mono or oligoclonal expansions of T cells mainly of CD8+ lineage in psoriatic skin (47–49). TCRBV expansion indicates antigen-driven CD8+ T cell responses, whereas the CD4+ T cell fraction was reported to be polyclonal (50). In patients with cutaneous psoriasis, however, the presence of oligoclonal TCRBV expansion in peripheral blood is debated (51, 52). Two different studies of high-throughput sequencing of the entire TCR repertoire have shown that alongside with a limited oligoclonally expanded T cell subpopulation in psoriatic skin that was in part retained in resolved lesions, there was a vast majority of polyclonal T cells (42, 53). This data suggests that similarly to what has been described in PsA by Winchester and co-workers, antigen-driven mono and oligoclonally expanded T cell populations represent a limited component of the T cell reactions in psoriatic skin, whereas the vast majority is represented by polyclonal CD4+ T cells that are not present in resolved lesions (54).

This evidence together confers to autoreactive CD8+ T cells a dominant role in the plaque formation and in psoriasis recurrence and possibly a common role in psoriasis and PsA. It also underlines the importance of mechanisms of T cell plasticity and polarization toward pathogenic phenotypes.

With respect to CD8 T cell targetability, a recent study on a AGR mouse model of psoriasis has reported the accumulation of epidermal CD8+ T cells during psoriasis development which was associated with IL-17A production and increased keratinocyte proliferation. Importantly, in this study injection of anti-CD8 antibody completely prevented psoriasis development (29).

Nevertheless, it is likely that Tc1/Tc17 autoreactive CD8+ TRM cells overlap their features and functions with the cells that under physiological conditions work as immune sentinels at barrier tissue. For this reason in a clinical setting, it could be difficult to target epidermal CD8+ TRM cells by the available immunotherapeutic tools without incurring in major adverse effects (20, 28, 29, 37).

As regards T helper cells, they have been reported to be more abundant in psoriatic skin lesions. While initially they were described mainly as Th1 cells, more recently the attention has been focused on IL-17-producing cells and the IL-23/Th17 axis clearly emerged as central in the control of the pro-inflammatory cycle in psoriatic plaques (14, 15). The high efficacy and fast outcome of IL-17A blocking therapies in resolving cutaneous clinical symptoms has strongly supported this concept (28, 55, 56). In addition, at skin level an expanded subset of T cells that produces IL-22 but not IL-17A (Th22) with a main role in the induction of acanthosis was identified. Importantly, these cells were found to be present also in resolved psoriatic lesions (57, 58).

In line with the key role of IL-17A, the main gene variants associated with psoriasis outside the MHC locus are single nucleotide polymorphisms, belonging to the IL-23/IL-17A axis (IL23R, IL12B, and IL23A) and the NF-κB pathway (TNFAIP3) (44, 59). It is, however, possible to hypothesize that Th17 or pathogenic Th1/Th17 cells could be expanded in the dermis as an event downstream of the epidermal autoimmune TRM and occurs through bystander activation mechanisms like the one described by Winchester and co-workers in psoriatic synovial tissues (54).

In this view, the cycle that develops around the IL-23/IL-17A axis could involve some antigen-driven populations and a considerable fraction of polyclonally expanded T cells that can represent the second step of the pro-inflammatory cascade, responsible for the amplification of inflammation and for the exacerbation of clinical symptoms (Figure 1B).

As a consequence of the strong evidence of the central role of IL-17A-producing cells, the relevance of Th1 cells and IFNγ has become less clear. In lesional skin of psoriasis patients, Th1 cells and IFNγ levels are clearly increased (60, 61). However, in a small pilot study in patients with psoriasis, treatment with a humanized anti-IFNγ antibody induced improvement of histological and some clinical parameters but only minor therapeutic effects (62).

These controversial findings focus on the complexity of the interplay between the Th1/Tc1 and Th17/Tc17 cells in the pathogenesis of psoriasis and it is not clear how the marked increase of IFNγ and IFNγ-producing cells in psoriatic skin can actually link with the failure of IFNγ-blockade to show therapeutic efficacy.

Results from a study by Kryczek et al. have suggested that IFNγ exerts one of its effects by programming myeloid dendritic cells to produce CCL20, ligand of CCR6, and to secrete IL-23. This in turn would favor the recruitment and expansion of IL-17A-producing cells (63, 64). On the other hand, IFNγ mRNA is markedly upregulated in psoriatic plaques and noticeably IFNγ-induced genes, such as CXCL9, CXCL10, and CXCL11 are strongly increased in psoriatic lesions (65).

In line with this evidence, we have previously reported gene expression data in psoriatic skin showing significant enhancement of CXCR3 and CXCL10 expression with an inverse correlation between the circulating fraction of CXCR3+ CD4+ effector memory T cells and the severity of cutaneous psoriasis (66, 67). Therefore, we can postulate an ultimate downstream phase in the psoriatic cascade, driven by the CXCL10/CXCR3 axis which induces the recruitment of Th1/Tc1 from the blood stream (Figure 1C).

T Cells in the Pathogenesis of PsA

Psoriatic arthritis develops in a fraction of patients with psoriasis and in the majority of cases it follows the development of the cutaneous disease by a mean of 10 years (68).

In addition to the skin, PsA targets the attachment sites of ligament to bone (entheses), the peripheral joints, and the spine (12, 69).

Enthesitis is indeed a distinctive feature of PsA and it has been hypothesized that, in PsA joints, inflammation can start from the entheses. The disease progression, in patients with PsA, can finally lead to destructive bone loss and 67% of patients exhibit signs of erosive bone disease (70).

Similarly to psoriasis, T cells are involved in the pathogenesis of PsA and reduction of CD3+ cells in PsA synovium correlated with the clinical response to biological therapies (71).

In PsA patients, Canete and co-workers have evidenced the presence of lymphoid aggregates in synovial tissues that was significantly reduced by TNF-blocking agents. This result could be paralleled by the observation of lymphoid aggregates in psoriatic skin and the role of CCR7/CCL19 axis, modulated by TNF in the initial clustering of dendritic cells and T cells in the dermis (4, 5, 72–75).

In line with the concept of shared pathogenic mechanisms between psoriasis and PsA, Belasco and colleagues provided the evidence that gene expression in PsA synovium was more closely related to gene expression in the PsA patient skin than to gene expression in the synovium of patients with other forms of arthritis. IL17 gene, however, was upregulated more in skin than in the synovium, whereas TNF and IFNγ were similarly upregulated in both tissues (76).

As regards the TCR repertoire analysis in PsA joints, Tassiulas et al. (47) showed oligoclonal and monoclonal T cell expansions in the synovial tissue, some of which were shared with the skin. In a subsequent study, Curran et al. performed TCR β-chain nucleotide sequencing in peripheral blood and synovial tissues/fluid showing that 76% of the clones in inflamed tissues were polyclonal, whereas 12% of the expanded clones had structurally homologous CDR3 β-chain sequence and were only CD8+ in lineage (54). Interestingly, some of the expanded CD8+ clones identified in the synovial tissue were present also in peripheral blood and joint fluid.

A second population of moderately expanded inflammation-related clones, that were either of CD4+ or CD8+ lineage, was identified only in inflamed synovial tissue and joint fluid. These cells could represent a secondary consequence of the inflammation induced by other proliferating clones.

Finally, one major population consisted of unexpanded polyclonal CD4+ T cells that did not persist in the tissue during methotrexate treatment, were most likely effector memory CD4+ T cells recruited by inflammatory chemokines released by other cell populations. The lack of clonal expansion in CD4+ T cells suggests a lower hierarchical role in driving inflammation.

These findings together suggest a role for cognate T cell responses in the pathogenesis of PsA and further suggest that T cell clones specific for identical or homologous antigens in skin and synovium may represent central elements in promoting inflammation in both tissues (47).

It remains to be established how self-reactive T cell responses in the skin, can be mechanistically linked to the one found in the synovial fluid and how these events can occur with years of time-lapse.

To this end, genetic association studies can provide some interpretation keys. In addition to the HLA-C*06:02 which is common with psoriatic plaque, additional HLA-alleles are associated with PsA. These HLA-alleles include B*08:01:01, B*27:05:02, B*38:01:01, and B*39:01:01 (77).

This underlines the importance of CD8+ T cells recognizing HLA-class I associated self-antigens in the pathogenesis of PsA and suggests that the autoimmune basis of PsA may be even broader than the one of cutaneous psoriasis. In this view, enthesis that anatomically links mechanical stress to immunologically active tissue (synovium), could be central for the pathogenesis (78).

Entheses are commonly subject to microdamage associated with local cytokine release, which may evolve into subsequent inflammation (79, 80). Inflammation in turn can favor cross-presentation of self-antigens.

It is, therefore, possible that recirculation of pathogenic skin T cells recognizing common self-antigens can start subclinical inflammation by localizing to the synovioenthesial complex (Figure 1C).

Patients with psoriatic disease have shown an increased level of circulating CCR6+ CD4+ TEM and TEFF cells that correlated positively with systemic inflammation (66). Therefore, it is possible to hypothesize that a fraction of IL-17-producing T cells recirculates from the skin and relocalize to the entheses.

This is reinforced by the findings of Sherlock et al. reporting that IL-17A+ cells locate mainly at the entheses and synovial tissues and by the evidence that among the genetic risk factors outside the MHC locus there are gene variants falling into the IL-23/IL-17A axis (77, 80–85). Importantly, it has been reported that IL-23 is expressed in synovial membrane with ectopic lymphoid tissue (78).

The fraction of IL-17A-producing cells recirculating from the skin could, therefore, determines subclinical inflammation and favor, in the long-term, cross-presentation of self-antigens and epitope spreading phenomena (73, 78).

In established PsA, it has also been reported an increased percentage of IL-17A-producing CD8+ T cells in synovial fluid which correlate with bone erosion and disease severity (86–88).

In the light of a hierarchical T cell clonality in psoriatic tissue and the evidence of the multiple-specific clones, including EBV-specific clones, observed in synovial fluid, we can postulate that massive recruitment of T cells with Th1/Tc1 phenotype from peripheral blood occurs as a consequences of inflammatory chemokine release (54). By analogy with the observation in psoriatic skin and by evidence from the data provided by Gladman and co-workers it is possible that CXCL10/CXCR3 axis can act as a downstream cell recruitment mechanism of tissue inflammation common to cutaneous psoriasis and PsA (89–91).

T Cells in Psoriasis-Associated Cardiovascular Comorbidities

Increasing epidemiological and clinical evidence indicates that psoriasis is an independent risk factor for cardiovascular disease (92, 93).

As a consequence of poorly controlled tissue inflammation, psoriasis patients can develop systemic inflammation and atherosclerosis. In this process, it has been postulated that inflamed tissue-derived factors or cells may directly affect distant vessels for the development of athero-thrombosis (7, 94, 95). Nevertheless, the cellular mechanisms that link the cutaneous manifestations of plaque psoriasis with the initiation and progression of atherosclerosis in psoriasis patients are largely unknown.

A recent study on human tissues showed that psoriasis and atherosclerosis exhibit significant overlap of their transcriptomes and in particular that TNF, IFNg, and IFNγ-induced genes, which are common between psoriasis and atherosclerosis may provide the link between the two diseases (96). By contrast, IL-17A and CCL20 were higher in psoriasis than in atherosclerotic tissue, whereas IL17R gene was expressed at similar levels.

Because of the link between IL-17A and neutrophil infiltration in atherosclerotic plaques and its key role in the pathogenesis of psoriasis it has been suggested that the IL-17A/neutrophil axis could take part to atherogenesis associated with psoriatic disease (97). Nevertheless, the role of IL-17A in psoriasis-associated atherosclerosis is still controversial. Indeed, Usui et al. reported that IL-17A deficiency protected against atherosclerosis in apoE−/− mice due to reduced macrophage infiltration and inflammatory cytokine secretion in the lesions (98).

Other mouse studies have indicated that IL-17A may promote plaque stability by contributing to fibrous cap formation (99). Collectively, the results indicate that IL-17A may exert both anti- and pro-atherogenic effects, depending on the inflammatory context. However, further studies will be necessary to clarify the contribution of T cells recirculating from the psoriatic plaque in the development of atherosclerosis.

Implications for the Development of Therapeutic Protocols

From this analysis it emerges a differential contribution of the individual subsets of T cells in the pathogenesis of psoriasis, PsA, and associated cardiovascular comorbidities namely, atherosclerosis. In particular, TNFα has a relevant role in inducing the CCL19/CCR7-mediated formation of clusters of dendritic cells and T cells in both psoriasis and PsA. It also emphasizes the role of IL-23/IL-17 axis in the amplification loop critical for the clinical manifestations of cutaneous psoriasis and possibly in the initial phase of join inflammation.

On the other hand, the possibility of a third step of CXCL10/CXCR3-mediated recruitment of Th1/Tc1 cells from the blood stream may explain the apparent controversy between the high amount of IFNγ-producing cells and the low therapeutic efficacy of anti-IFNγ antibody treatment.

Conclusion

By defining the hierarchy of the T cell-mediated events of the psoriatic cascade in psoriatic plaques it is possible to distinguish a core antigen-driven oligo or monoclonally expanded autoreactive CD8+ T cell component, a secondary self-reactive CD4+ T cell component, a polyclonal CD4+ Th17 and pathogenic Th1/Th17 population amplified by the IL-23/IL-17A axis, and a downstream recruitment of CXCR3+ T cells with different specificities induced by the upregulation of CXCL10 chemokine. Similarly in PsA the analysis of the TCR repertoire has evidenced central antigen-driven expansion of mainly CD8+ T cells and broad polyclonal CD4+ T cells expansion. In addition, a group of common clones were also expanded in peripheral blood of patients with PsA and T cell clones specific for identical or homologous antigens were present in both skin and in synovial tissues. These may represent central elements in promoting inflammation in both tissues. In addition, oligoclonally expanded clones in peripheral blood of patients with PsA may also suggest that T cell recirculation can represent a mechanistic link between skin and joints inflammation.

Author Contributions

FC wrote parts of the manuscript and prepared the figures. PP collaborated to the writing. PS and RG discussed the content and critically revised the manuscript. ER supervised the work and wrote the final version of the manuscript.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding

The Psoriasis Research Program at the University of Ferrara receives support from Fondazione Natalino Corazza Onlus Psoriasis & Co., Bologna, Italy.

References

Psorilax:Acquista |vedi crema schiuma per psoriasi enstilar

0

Psorilax: prezzo, funziona, recensioni, opinioni, quanto costa

A woman who claims she cured her chronic skincare problems with a bespoke diet claims she could save the NHS millions with her meal plan.

Hanna Sillitoe, 38, from Manchester suffered with psoriasis, acne and eczema for 20 years before developing her own anti-inflammatory diet rich – swapping caffeine, alcohol, sugar, dairy and wheat for leafy green vegetables, cold pressed juices and coconut oil.

After penning a book of her favourite healthy recipes, the author has shared images of the dozens of readers from around the world who say her diet has helped them with their own skincare woes.

Before she discovered her ‘cure’, Hanna was constantly in pain and felt so self-conscious she became ‘lazy, fat and was covered up all the time’.

Transformation: Hanna Sillitoe, 38, from Manchester suffered with psoriasis, acne and eczema for 20 years before developing her own anti-inflammatory diet

Transformation: Hanna Sillitoe, 38, from Manchester suffered with psoriasis, acne and eczema for 20 years before developing her own anti-inflammatory diet

At one point Hanna’s discomfort was so unbearable she covered her body in coconut oil and wrapped herself in cling film in a desperate attempt to stop the itching.

Turning point: Hanna finds her own ‘cure’

After trying an exhausting list of prescription drugs, it was only when Hanna’s doctor offered her chemotherapy that she took matters into her own hands, researching and creating her own bespoke diet.

Four years later, she boasts a glowing complexion and has even written her own recipe book and launched a successful blog.

Is £2bn spending a ‘waste’ of money?

Hanna is speaking out in the wake of a recent study showing that the NHS spends an astonishing £2bn on treating skin problems each year.

And the author believes her diet could drastically reduce that spend and offer hope to thousands of sufferers.

She said her skin previously felt 'scaly like a lizard'

One reader, known only as Norba (@norbagaygay Sharing her amazing diet results on Instagram) after just two months

One reader, known only as Norba (@norbagaygay) sharing her amazing diet results on Instagram) after just two months. She said her skin previously felt ‘scaly like a lizard’

Sarah Davies from Pembrokeshire; Sarah’s before pics are from February

She’s a beautician and continued working even whilst her skin was at its worst

Sarah Davies from Pembrokeshire; Sarah’s before pics are from February. She’s a beautician and continued working even whilst her skin was at its worst

Alice, from Malaysia, featured in Hanna's book Radiant

Her psoriasis cleared up dramatically on her back thanks to the diet

Alice, from Malaysia, featured in Hanna’s book Radiant after her psoriasis cleared up dramatically on her back thanks to the diet

She told MailOnline FEMAIL: ‘The statistics on NHS spending are saddening and more than anything, incredibly frustrating.

‘Time after time people come to me with the same story – their GP is not really sure what the skin condition is, but is fairly convinced switching to a healthy, plant based diet will not play a part in clearing it.

‘I am here to tell them that very often they are wrong. I struggled with skin conditions including acne, eczema and psoriasis for over 20 years.

‘I spent many months throughout those two decades moving around the UK for work and saw various GPs and dermatologists.

‘Some were most definitely more sympathetic than others, but when it came to diet and lifestyle not once was I asked what I ate and never was it suggested that I might want to look at changing it.

Success: Hanna has turned her expertise into a book, Radiant , featuring 100 of her favourite recipes, which is currently available on Amazon

Success: Hanna has turned her expertise into a book, Radiant , featuring 100 of her favourite recipes, which is currently available on Amazon

Fighting fit: But before she discovered her 'cure', Hanna was constantly in pain and felt so self-conscious she became 'lazy, fat and was covered up all the time'

Fighting fit: But before she discovered her ‘cure’, Hanna was constantly in pain and felt so self-conscious she became ‘lazy, fat and was covered up all the time’

Hannah's new diet is consists of swapping caffeine, alcohol, sugar, dairy and wheat for leafy green vegetables, cold pressed juices and coconut oil

Hannah’s new diet is consists of swapping caffeine, alcohol, sugar, dairy and wheat for leafy green vegetables, cold pressed juices and coconut oil

‘I remember specifically asking my dermatologist about going gluten free as I’d read an article on wheat being potentially problematic for psoriasis, she just smiled and said there’s no evidence to show diet will make the slightest bit of difference.’

Hanna’s secret recipe for better skin

Hanna added: ‘The problem with that is, for someone like me who was eating too much processed food, refined carbohydrates and sugars and who may also drink and smoke, there’s absolutely no incentive to make changes to our diet.

‘Making these changes can be tough. We look to a GP for guidance, and if the doctor is not recommending dietary change, that’s all the excuse we need not to bother.’

Skincare woes began when she was just 16

Hanna, whose skin problems began when she was a teenager, previously told FEMAIL: ‘I was always the spotty one among my friends and struggled with severe acne throughout my school years. My psoriasis started when I was 16.’

She believes her first flare-up was caused by her poor diet, the stress of GCSE exams and her parents splitting up.

Hanna began posting pictures of her skin on Twitter and, after people started asking her what foods she ate, Hanna launched a blog (MyGoodnessRecipes.com) and Instagram (@mygoodnessrecipes) with her favourite recipes which led to a free guide

Hanna began posting pictures of her skin on Twitter and, after people started asking her what foods she ate, Hanna launched a blog (MyGoodnessRecipes.com) and Instagram (@mygoodnessrecipes) with her favourite recipes which led to a free guide

After penning a book of her favourite healthy recipes, the author has shared images of the dozens of readers from around the world who say her diet has helped them with their own skincare woes

After penning a book of her favourite healthy recipes, the author has shared images of the dozens of readers from around the world who say her diet has helped them with their own skincare woes

Hanna admits that she isn't a trained nutritionist, but wants to share what's worked for her after carrying out lots of research

Hanna admits that she isn’t a trained nutritionist, but wants to share what’s worked for her after carrying out lots of research

‘It began as a lot of little red dots on my tummy,’ she said. ‘I still remember the doctor telling me ‘There is no cure”. The thought of being stuck with it forever was horrific.’

Hanna went to extreme lengths to get rid of her psoriasis and even tried coal tar shampoo which her boyfriend joked made her smell of ‘tarmac’, but to no avail – it got so bad she began dreading holidays and summer weddings where her skin would be on show.

‘I used foundation and concealer on my arms, I wore long sleeves and trousers in summer, I did everything I could to cover up and hide,’ Hanna said. ‘I absolutely hated my skin.’

On one occasion, she was waiting to board a flight to Egypt when the girl behind the check-in desk started pointing and called for her colleague.

Lara @iaraharvey. 'Her smile says it all!' says Hanna. 'Sharing her before and after pics on instagram These are taken just a few weeks apart'

Lara now

Lara @iaraharvey. ‘Her smile says it all!’ says Hanna. ‘Sharing her before and after pics on instagram These are taken just a few weeks apart’

Warda before

Warda, from Sweden, featured in Hanna's book Radiant after her psoriasis on her legs dramatically reduced

Warda, from Sweden, featured in Hanna’s book Radiant after her psoriasis on her legs dramatically reduced

Jessie says the diet has 'changed her life', with these two pictures taken just one month apart

Hanna said: 'Amazing before and after pics'

Jessie says the diet has ‘changed her life’, with these two pictures taken just one month apart. Hanna said: ‘Amazing before and after pics’

‘In front of a long queue of people they began a huge discussion over whether my skin was contagious,’ Hanna recalled. ‘I was absolutely distraught.’

Desperate measures to stem the pain

During her worst flares, the pain and itching was ‘unbearable’ and Hanna would wake up to 10 times in the night to slather on moisturiser to try and soothe it.

Once, travelling to London for a meeting, she covered her body in coconut oil and wrapped herself in clingfilm to stop the clothes from rubbing against her skin.

Over the years she tried ‘countless prescription creams, shampoos and emollients’, many containing coal tar and steroids, to little avail.

Finally, four years ago, she went to her doctor ‘in despair’ and he suggested Methotrexate, an immune system suppressant.

Grace @skinhealinggrace shows her incredible progress after taking up Hanna's diet

Grace now

Grace @skinhealinggrace shows her incredible progress after taking up Hanna’s diet

This reader, known only as Mr Leong, said his wife read Hanna's story on a Hong Kong website after they picked it up from the MailOnline last year

Mr Leong now

This reader, known only as Mr Leong, said his wife read Hanna’s story on a Hong Kong website after they picked it up from the MailOnline last year

Glenda from Surrey is a mum of two and came to Hanna's Croatia retreat last year

Her results are 98% clear with no meds

Glenda from Surrey is a mum of two and came to Hanna’s Croatia retreat last year. She continued to follow everything she learned about skin friendly foods and her results are 98% clear with no medication

‘I was shocked,’ said Hanna. ‘This was chemotherapy medication and I didn’t have cancer, just a skin problem.

‘I went home to read and research a little more. The list of side effects – which include organ failure – made the decision an easy one. I was petrified, there was absolutely no way I was going down that route.’

Finding her own solution to the problem

Hanna began trawling the internet for alternative solutions and read about men who had healed their autoimmune skin conditions by juicing – extracting the juice from fresh fruit and vegetables to give their bodies a ‘break from digestion’.

‘I absolutely love food and knew I couldn’t live on juice for the rest of my life,’ said Hanna, who began developing her own anti-inflammatory recipes despite having ‘n catering experience whatsoever.

This woman, known only as Aci, followed Hanna on Instagram. A 35-year-old mother of two, her skin went crazy after her second baby

Her tummy is now clear after five weeks

This woman, known only as Aci, followed Hanna on Instagram. A 35-year-old mother of two, her skin went crazy after her second baby. Her tummy is now clear after five weeks

Beautician Sarah Davies, from Pembrokeshire, read Hanna's story in the MailOnline after a friend sent it to her. She was stressed out, with lots of emotional worries and a poor diet

Sarah Davies now

Beautician Sarah Davies, from Pembrokeshire, read Hanna’s story in the MailOnline after a friend sent it to her. She was stressed out, with lots of emotional worries and a poor diet

Emma, from the UK; Steroid creams had had absolutely no effect and Emma was ready to give up

Following Hanna's book she saw results in just weeks, the author says

Emma, from the UK; Steroid creams had had absolutely no effect and Emma was ready to give up. Following Hanna’s book she saw results in just weeks, the author says

‘I’d lived on pasta and tomato sauce out of jars forever,’ Hanna admitted. ‘The process really was very much trial and error but I loved the challenge.’

Despite an initial flare-up, her skin began to clear up just two weeks into her new ‘alkaline-focused’ diet full of nuts, greens and seeds.

‘From that day onward my skin got better and better,’ Hanna said. ‘Each day there was a little change.

‘By day 30 I went out in short sleeves for the first time in years – that moment made it all worthwhile.’

New lease of life for the skincare guru

The confidence that came from her newfound glow gave Hanna the boost needed to start exercising, whereas before she would ‘happily spend my evenings sat around eating pizza and drinking wine’.

She began posting pictures of her skin on Twitter and, after people started asking her what foods she ate, Hanna launched a blog (MyGoodnessRecipes.com) and Instagram (@mygoodnessrecipes) with her favourite recipes which led to a free guide.

One of Hanna's happy readers

Hanna now describes herself as an 'author, dietician and chef' and travels the country attending food festivals

One of Hanna’s happy readers. Hanna now describes herself as an ‘author, dietician and chef’ and travels the country attending food festivals

The diet consists of swapping caffeine, alcohol, sugar, dairy and wheat for leafy green vegetables, cold pressed juices and coconut oil

Another happy reader

The diet consists of swapping caffeine, alcohol, sugar, dairy and wheat for leafy green vegetables, cold pressed juices and coconut oil

Hanna eventually turned her expertise into a book, Radiant, featuring 100 of her favourite recipes, which is currently available on Amazon.

These days, hundreds of women suffering from psoriasis and eczema confide in her and send in pictures showing the difference her diet has made.

Hanna now describes herself as an ‘author, dietician and chef’ and travels the country attending food festivals.

Her favourite recipe from her book is a lasagne with no pasta, tomato or cheese as well as a millionaire’s shortbread because ‘it’s amazing to show people that a lifestyle change such as this one really doesn’t mean living on green sludge and celery sticks forever!’

What are the worst foods for people with skin problems?

Hanna's book includes research and recipes to heal psoriasis and eczema

Hanna’s book includes research and recipes to heal psoriasis and eczema

Author Hanna Sillitoe admits that she isn’t a trained nutritionist, but wants to share what’s worked for her after carrying out lots of research.

Here is a selection of food and drinks Radiant: Recipes to Heal Your Skin From Within recommends sufferers of psoriasis and eczema to avoid:

Caffeine

Caffein stimulates the nervous system, causing our adrenals to pump out cortisol. Cortisol is a hormone which helps the body respond to stress. Those same stress hormones that prepare us for a ‘fight or flight’ response also have the potential to trigger skin conditions such as acne.

Cortisol depresses the immune system, making it much more difficult for our skin to fight off bacteria, which multiply inside clogged pores.

Cortisol also encourages the body to pump out insulin. Not only can insulin trigger over-production of new skin cells, it also increases the body’s inflammation levels, which can exacerbate an existing skin condition, causing skin to appear redder and more swollen.

Alcohol

Alcohol is a natural diuretic, which means that the more you drink, the more dehydrated you become. It literally saps the moisture from every part of your body, skin included.

Drinking too much deprives the skin of vital vitamins and nutrients. Vitamin A, for example, is essential for cell renewal and a lack of it can cause the skin to look dull and grey.

Check labels, because alcohol as a major ingredient in any skin-care product is most definitely a problem.

Sugar

Sugary carbohydrates cause our insulin levels to spike and this can lead to an inflammation flare-up throughout the body, potentially causing stress, redness and visible swelling on the skin’s surface.

Autoimmune illnesses such as psoriasis are activated by an over-responsive immune system.

Hanna found that removing sugar from her diet provided great relief

Hanna found that removing sugar from her diet provided great relief

Foods such as sugar, sweets, ice cream, white pasta, ketchup, pre-packaged snacks and fizzy drinks are some of the worst culprits.

Digested sugar permanently attaches to the proteins in our skin through a process known as glycation. Over time, the end products accumulate and destroy our collagen and elastin, the proteins responsible for keeping skin firm and supple.

Processed and junk food

Processed foods contain chemicals, plus cheap fats and refined vegetable oils that are often hydrogenated.

Also known as trans fats, these oils increase bad cholesterol and can block the production of chemicals that combat inflammation.

A good rule of thumb to improve the health of your skin, is to eat foods that keep your blood sugar levels steady. Almost all processed and junk foods are full of ingredients that will cause blood sugar to quickly soar.

This rapid spike triggers the metabolism to boost insulin in response, which in turn creates a flare of inflammation. Over time high insulin levels can make skin drier, thicker and flaky, often blocking the pores and resulting in acne.

Nightshades (tomatoes, potatoes, aubergine and peppers)

Edible plants of the Solanaceae family, known as the nightshades, are not advisable for anyone struggling with autoimmune skin conditions such as psoriasis.

The alkaloids in nightshade vegetables are believed to provoke gut irritation – the condition known as leaky gut.

There is however, a great deal of anecdotal evidence and blog posts from people who have found that nightshades aggravate their autoimmune illness.

Everyone is different, so as always, it’s important to establish whether these foods are posing a real problem for you.

Hanna advises people see if cutting out dairy will help

Hanna advises people see if cutting out dairy will help

Dairy

Dairy is very, very hard to digest, even in those of us that don’t have a diagnosed allergy. It’s one of the most acidic, inflammatory foods we can eat.

To take care of our skin, we want to eat as many anti-inflammatory foods as possible. All animal protein is inflammatory to some degree but it is specifically dairy proteins that have been linked to skin problems.

Wheat

For many people, identifying a wheat or gluten allergy can be the missing link to clearing skin and resolving a whole host of underlying health problems.

The reason wheat is thought to be such an issue for those of us with skin problems is primarily because it’s high on the glycaemic index. High GI foods prompt raised blood sugar, in turn triggering insulin. Not only are elevated insulin levels linked to increased sebum production that can clog pores and lead to acne breakouts, more worryingly they promote chronic inflammation throughout the body.

The book, published by Kyle Books, is priced at £10.77 and is available here.

Hanna’s blog can be found here.

Psorilax:Dove trovare online |elidel crema per psoriasi intima

0

Psorilax: prezzo, funziona, recensioni, opinioni, come si usa

Una recente revisione sistematica della letteratura ha confermato che le terapie biologiche possono riattivare il virus dell'epatite B (HBV) nei pazienti con psoriasi a placche.1 Sebbene lo studio abbia scoperto che qualsiasi precedente esposizione all'HBV era associata al rischio di riattivazione virale, i pazienti con HBV cronica avevano molte più probabilità di sperimentare la riattivazione rispetto a quelli con evidenza di esposizione all'HBV ma senza epatite. La profilassi antivirale ha notevolmente ridotto il rischio di riattivazione virale nella coorte cronica dell'HBV.1 I risultati dello studio sottolineano l'importanza dello screening di tutti i pazienti con psoriasi per l'infezione da HBV prima di prescrivere un farmaco biologico o altra terapia immunosoppressiva.1,2

Screening per l'esposizione al virus dell'epatite B.

In tutto il mondo, circa 2 miliardi di persone sono state esposte all'HBV e oltre 350 milioni vivono con l'HBV cronico.2,3 Negli Stati Uniti, ogni anno vengono diagnosticati 21.000 casi di HBV e tra 850.000 e 2,2 milioni di persone hanno HBV cronico.4 Pertanto, la maggior parte dei dermatologi incontrerà pazienti con psoriasi che sono stati o saranno esposti all'HBV. Tutti gli agenti immunosoppressori (biologici e non biologici) sono associati ad un aumentato rischio di riattivazione dell'epatite e molti agenti usati per trattare la psoriasi hanno effetti immunomodulatori.2 Inoltre, alcuni trattamenti per la psoriasi sono potenzialmente epatotossici.1-3 Pertanto, gli esperti raccomandano di sottoporre a screening tutti i pazienti con psoriasi per infezione da HBV prima di iniziare la terapia immunosoppressiva.1-3 I rapporti dei pazienti sull'esposizione all'epatite sono inaffidabili perché molte persone eliminano il virus senza mai rendersi conto di essere infetti.

Come minimo, i pazienti devono essere sottoposti a screening per i seguenti marcatori sierologici: antigene di superficie dell'epatite B (HBsAG), anticorpo di superficie dell'epatite B (anti-HBs o HBsAb) e anticorpo totale dell'epatite B (anti-HBc o HBcAb).2 I risultati sierologici vengono combinati per identificare le diverse fasi dell'infezione da HBV (vedere la tabella).5 I pazienti senza evidenza di esposizione all'HBV sono considerati “sensibili” e devono essere inoculati contro l'HBV prima di iniziare la terapia immunosoppressiva.2 Una vaccinazione di richiamo deve essere presa in considerazione per i pazienti che sono stati vaccinati ma che hanno un titolo HBsAb <10 mIU / mL, indicando la mancata risposta alla vaccinazione.2 I pazienti che hanno riscontrato un'infezione da HBV acuta o cronica devono essere indirizzati a un epatologo per la valutazione e ulteriori test prima di iniziare la terapia immunosoppressiva.2

Terapia biologica e riattivazione dell'epatite B.

I medici in genere preferiscono i nuovi agenti biologici per la gestione dei pazienti con psoriasi con disfunzione epatica perché sono meno epatotossici rispetto agli agenti immunosoppressori più vecchi come il metotrexato e la ciclosporina.1-3 Classi di agenti biologici usati per trattare la psoriasi includono inibitori del fattore di necrosi tumorale (TNF) -α e anticorpi monoclonali che bloccano varie interleuchine (IL).1

Gli studi condotti su pazienti con HBV cronico e artrite reumatoide o malattia di Crohn hanno collegato gli inibitori del TNF-a ad un alto rischio di riattivazione dell'HBV.6,7 Il meccanismo alla base della riattivazione dell'HBV non è chiaro, sebbene l'evidenza degli studi in vitro e in vivo suggerisca che il blocco del TNF-α comprometta la capacità del sistema immunitario di eliminare il virus.6 L'inibizione del TNF-α può anche migliorare la replicazione dell'HBV.

Sebbene non esista una definizione universale di riattivazione dell'HBV, viene comunemente definita come “un aumento della replicazione dell'HBV di almeno 1 log 10 copie / mL o la conversione del DNA dell'HBV sierico da negativo a positivo.”1 Subito dopo la reazione dell'HBV, i pazienti che presentavano uno screening positivo per HBsAG mostreranno un aumento dei livelli sierici di HBV-DNA, mentre i pazienti che inizialmente presentavano uno screening negativo per HBsAg o avevano un livello sierico non rilevabile di HBV-DNA verranno sottoposti a screening positivo per HBsAG o HBV-DNA sierico .6

Le conseguenze della riattivazione dell'HBV sono potenzialmente gravi. Sebbene alcuni pazienti possano manifestare nient'altro che un aumento asintomatico degli enzimi epatici sierici, altri possono sviluppare un'epatite grave o soffrire di insufficienza epatica potenzialmente fatale.8 La mitigazione della lesione epatica dipende dalla diagnosi precoce e dalla gestione appropriata, che può includere la terapia immunosoppressiva e l'inizio della terapia antivirale.6

Quantificazione del rischio di riattivazione dell'epatite B nei pazienti con psoriasi mediante terapia biologica

L'esame più completo del rischio di riattivazione dell'epatite nei pazienti con psoriasi trattati con terapia biologica è stata un'analisi sistematica che comprendeva 49 studi (3 virus dell'epatite C (HCV), 46 HBV): 1 prospettico, 15 retrospettivi e 33 serie o rapporti di casi.1 Le terapie biologiche utilizzate negli studi includevano gli inibitori del TNF-α etanercept (53%), adalimumab (22%), infliximab (8%) e golimumab (0,3%); il bloccante IL-12/23 ustekinumab (13%); il secukinumab bloccante IL-17 (0,9%); e 2 prodotti biologici non più commercializzati (alefacept ed efalizumab).1

Cumulativamente, gli studi hanno incluso 215 pazienti con psoriasi da moderata a grave ampiamente classificati come affetti da HBV cronico (n = 40) o come sieropositivi per HBV ma senza epatite attiva (n = 175).1 Quest'ultimo gruppo consisteva principalmente di pazienti con infezione da HBV passata risolta, ma potrebbe aver incluso alcuni che avevano avuto un'infezione da HBV occulta o un risultato anti-HBc falso positivo.1

Nella coorte cronica di HBV, il 20% dei pazienti (8/40) ha avuto una riattivazione dell'HBV, che si è tradotta in un tasso di riattivazione annuale del 14%.1 Stratificare i pazienti con HBV cronico secondo l'uso della profilassi antivirale ha prodotto un tasso di riattivazione molto più basso per i pazienti che hanno ricevuto la profilassi (3/26) rispetto a quelli che non lo hanno fatto (5/14; 12% contro 36%, rispettivamente); i tassi di riattivazione annuali erano rispettivamente del 7,7% vs 26%.1 Il tasso di riattivazione per i pazienti che erano positivi per l'anti-HBc ma che non avevano l'epatite era dell'1% (2/175) e il tasso di riattivazione annuale era trascurabile dello 0,32%.1

La revisione ha diverse imitazioni, tra cui la decisione degli autori di non stratificare i risultati per uso biologico, la mancanza di studi randomizzati controllati e la qualità incoerente degli studi incorporati.1 I risultati supportano la sicurezza delle terapie biologiche per i pazienti con precedente esposizione all'HBV che non hanno l'HBV cronico, tuttavia, e suggeriscono che questi pazienti potrebbero non richiedere la profilassi.

È possibile che il rischio di riattivazione virale differisca tra gli inibitori del TNF-α e che inibitori più potenti possano comportare un rischio maggiore.9,10 Ad esempio, i tassi di riattivazione dell'HBV riportati nei pazienti positivi all'HBsAg trattati con inibitori del TNF-α più potenti infliximab, adalimumab o certolizumab variano dal 12% al 39% rispetto all'1% al 5% con etanercept.10 Tuttavia, questi intervalli combinano i tassi osservati nei pazienti trattati per condizioni diverse e non possono essere estrapolati in modo affidabile ai pazienti con psoriasi. Inoltre, compromettere l'affidabilità delle valutazioni del rischio tra gli inibitori del TNF-a è il fatto che la maggior parte dei tassi di incidenza provengono da casi clinici o studi retrospettivi e non da studi ben condotti.9

I bloccanti di IL sono nuovi agenti usati per trattare la psoriasi e si sa meno su come influenzano il rischio di riattivazione dell'HBV con un uso prolungato in pazienti con psoriasi. In un piccolo studio con ustekinumab in pazienti con concomitante psoriasi ed esposizione a HBV, 2 su 7 pazienti con HBV cronica che non hanno ricevuto la profilassi antivirale hanno sperimentato la riattivazione dell'HBV (29%) rispetto a nessun paziente che aveva avuto HBV occulto o che hanno ricevuto profilassi antivirale.11 Il gruppo di studio della Società europea di microbiologia clinica e malattie infettive (ESCMID) ha condotto revisioni dei tassi di malattie infettive associate a varie interleuchine, immunoglobuline e fattori di complemento che includevano numerosi bloccanti IL approvati per la psoriasi a placche negli Stati Uniti o nell'Unione europea.12 Il gruppo ha concluso che ustekinumab era associato a un basso rischio di riattivazione dell'HBV, ma che i bloccanti IL-17 secukinumab, ixekizumab o brodalumab non aumentavano il rischio di riattivazione dell'HBV.12 Un avvertimento è che alcuni studi sui bloccanti dell'IL-17, inclusi gli studi di fase 3 per ixekizumab in pazienti con psoriasi, hanno escluso le persone con HBV cronico, i cui dati mostrano un rischio più elevato di riattivazione virale con l'uso di immunosoppressori.13

Conclusione

Nei pazienti con psoriasi precedentemente esposti all'HBV o che hanno l'HBV cronico, le terapie immunosoppressive possono causare riattivazione virale, sebbene il rischio sia minimo per i pazienti con infezione risolta o occulta. Gli studi hanno associato terapie sia biologiche che biologiche con un rischio di riattivazione. Pertanto, lo screening è consigliato per tutti i pazienti con psoriasi che contemplano il trattamento con un agente immunosoppressivo e il monitoraggio della carica virale dell'HBV in pazienti che sono anti-HBC positivi ma HBsAG-negativi. Sebbene gli agenti biologici siano sicuri da usare in pazienti con psoriasi con HBV cronico, il trattamento deve essere intrapreso in consultazione con un epatologo e questi pazienti devono essere monitorati per segni di riattivazione virale. Sono necessari studi prospettici su larga scala per comprendere meglio il rischio di riattivazione dell'HBV in pazienti con psoriasi sottoposti a trattamento con terapie biologiche e per confrontare il rischio di riattivazione tra diverse terapie biologiche.

Riferimenti

  1. Snast I, Atzmony L, Braun M, Hodak E, Pavlovsky L. Rischio di riattivazione del virus dell'epatite B e C in pazienti con psoriasi su terapie biologiche: uno studio di coorte retrospettivo e una revisione sistematica della letteratura. J Am Acad Dermatol. 2017; 77 (1): 88-97.
  2. Motaparthi K, Stanisic V, Van Voorhees AS, Lebwohl MG, Hsu S. Dal consiglio medico della National Psoriasis Foundation: raccomandazioni per lo screening per l'infezione da epatite B prima di iniziare gli inibitori del fattore-alfa necrosi antitumorale o altri agenti immunosoppressori nei pazienti con la psoriasi. J Am Acad Dermatol. 2014; 70 (1): 178-186.
  3. Fiore M, Leone S, Maraolo AE, Berti E, Damiani G. Malattia epatica e pazienti psoriasici. Biomed Res Int. 2018; 2018: 3.140.983.
  4. Centri per il controllo e la prevenzione delle malattie. Epatite virale: statistica e sorveglianza. Aggiornato il 18 aprile 2018. Accesso al 28 aprile 2018.
  5. Centri per il controllo e la prevenzione delle malattie. Interpretazione dei risultati dei test sierologici dell'epatite B. Accesso effettuato il 28 aprile 2018.
  6. Cannizzaro MV, Franceschini C, Esposito M, Bianchi L, Giunta A. Riattivazione dell'epatite B in pazienti con psoriasi trattati con agenti anti-TNF: prevenzione e gestione. Psoriasi (Auckl). 2017; 7: 35-40.
  7. Vilarrasa E, Puig L. Psoriasi: trattamento biologico e malattie del fegato. World J Dermatol. 2014; 3 (4): 76-85.
  8. Visram A, Feld JJ. Definizione e classificazione della riattivazione dell'HBV. Malattia epatica clinica. 2015; 5 (2): 35-38.
  9. Bessone F, Dirchwolf M. Gestione della riattivazione dell'epatite B in pazienti immunodepressi: un aggiornamento sulle raccomandazioni attuali. World J Hepatol. 2016; 8 (8): 385-394.
  10. Loomba R, Liang TJ. Riattivazione dell'epatite B associata a terapie immunosoppressive e con modificatori biologici: concetti attuali, strategie di gestione e direzioni future. Gastroenterologia. 2017; 152 (6): 1297-1309.
  11. Chiu HY, Chen CH, Wu MS, Cheng YP, Tsai TF. Profilo di sicurezza di ustekinumab nel trattamento di pazienti con psoriasi ed epatite B o C. concomitante Br J Dermatol. 2013; 169 (6): 1295-1303.
  12. Winthrop KL, Mariette X, Silva JT, et al. Documento di consenso del Gruppo di studio ESCMID per le infezioni negli ospiti compromessi (ESGICH) sulla sicurezza delle terapie mirate e biologiche: una prospettiva di malattie infettive (molecole di effettori immunitari solubili (II): agenti che prendono di mira interleuchine, immunoglobuline e fattori del complemento) (pubblicato online il 2 febbraio 2018). Clin Microbiol Infect. doi: 10.1016 / j.cmi.2018.02.002.
  13. Papp KA, Bachelez H, Blauvelt A, et al. Infezioni da sette studi clinici di ixekizumab, un anticorpo monoclonale anti-interleuchina-17A, in pazienti con psoriasi da moderata a grave. Br J Dermatol. 2017; 177 (6): 1537-1551.

Psorilax:in vendita |crema psoriasi unifarco

0

Psorilax: prezzo, funziona, recensioni, opinioni, dove si compra

Una volta attivata, una cellula immunitaria rivede il suo metabolismo, apportando modifiche che potrebbero essere sfruttate per il trattamento.

Spectrum Science Communications

Di Mitch Leslie

Circa 12 anni fa, Gary Glick e sua moglie hanno notato qualcosa di sbagliato nel loro figlio, Jeremy. Sembrava in ritardo rispetto alla sorella gemella, ricorda l'immunologo e biologo chimico dell'Università del Michigan ad Ann Arbor. “Stavano crescendo all'unisono e si è quasi fermato.” Jeremy, che all'epoca aveva 9 o 10 anni, sembrava anche malato e pallido e cominciò a lamentarsi di dolori fastidiosi allo stomaco e altrove.

Rachel Lipson Glick, un medico, era sconcertata dal misterioso disturbo del figlio. Così erano altri dottori. Ci sono voluti circa 3 anni per escludere una miriade di tumori, malfunzionamenti endocrini e altre potenziali cause e per determinare che Jeremy aveva la malattia di Crohn, un'infiammazione del tratto digestivo alimentata da cellule immunitarie che si comportavano male.

La diagnosi ha reso la vita più difficile per Jeremy, ora 22enne e senior al college. Per controllare i sintomi, inietta il farmaco anticorpale adalimumab (Humira). Probabilmente ne avrà bisogno, o un altro trattamento di inibizione immunitaria, per il resto della sua vita.

Per coincidenza, una di quelle alternative potrebbe derivare dal lavoro di suo padre. Gary Glick, come un numero crescente di altri ricercatori, è convinto che le condizioni di guida delle cellule immunitarie come la malattia di Crohn condividano una caratteristica che potrebbe essere la loro rovina: il loro metabolismo. Ha trascorso gli ultimi 2 decenni alla ricerca di farmaci mirati agli adattamenti metabolici delle cellule immunitarie. Gli studi clinici condotti da Lycera, una società fondata da Glick, stanno ora valutando il primo di quei farmaci per la psoriasi e la colite ulcerosa, una malattia intestinale correlata alla malattia di Crohn.

Le compagnie farmaceutiche stanno lavorando per sviluppare altri candidati. I ricercatori stanno anche cercando di distribuire farmaci esistenti che alterano il metabolismo, come i trattamenti per il diabete con metformina e 2-desossiglucosio (2DG). “È un momento molto emozionante”, afferma l'immunologo Jonathan Powell della School of Medicine della Johns Hopkins University di Baltimora, nel Maryland. “Potenzialmente, tutte le malattie immunologiche sono bersagli per la terapia metabolica.”

I ricercatori sul cancro hanno anche cercato di interrompere il metabolismo cellulare, anche testando alcuni degli stessi farmaci che gli immunologi stanno studiando. Ma molti scienziati sono convinti che la strategia funzionerà meglio per le malattie immunitarie che per i tumori perché i farmaci per curare queste malattie devono solo sopprimere un numero relativamente piccolo di cellule sovraesuberanti, non eliminarle. E mentre i farmaci esistenti che frenano le cellule immunitarie, come adalimumab, possono compromettere le nostre difese contro i patogeni, Glick e altri scienziati ritengono che l'inconveniente non influirà sulla loro strategia. Concentrandosi sul metabolismo delle cellule immunitarie iperattive, dice, offre “un modo per colpire direttamente queste cellule risparmiando la funzione immunitaria”.

Gary Glick (a sinistra) ha scoperto un farmaco che potrebbe portare a un trattamento per la malattia autoimmune che colpisce suo figlio Jeremy (a destra).

© Joe McNally

Negli anni 1920, il medico e chimico tedesco Otto Warburg fu il primo a rendersi conto che le cellule immunitarie hanno un modo distintivo di alimentarsi. Per alimentare le loro attività, le cellule devono produrre la molecola di adenosina trifosfato (ATP). Possono farcela direttamente attraverso la glicolisi, un percorso biochimico che smuove il glucosio. Oppure possono generare ATP attraverso un processo più coinvolto chiamato fosforilazione ossidativa, che richiede molecole cariche di energia prodotte dalla glicolisi ma ravviva anche altre reazioni biochimiche che degradano gli acidi grassi e gli aminoacidi come la glutammina.

Le cellule del corpo normali in genere si basano sulla fosforilazione ossidativa per la maggior parte dei loro bisogni energetici, ma Warburg ha scoperto che le cellule tumorali aumentavano la glicolisi. Ha anche notato che alcune cellule sane dipendevano dalla glicolisi: cellule immunitarie.

Warburg era sulla buona strada, ma i ricercatori ora sanno che quando le cellule immunitarie non combattono i patogeni, riducono il loro metabolismo e producono ATP principalmente attraverso la fosforilazione ossidativa. L'arrivo di una minaccia, come un virus influenzale che si riproduce nei polmoni, attiva le cellule, galvanizzandole per combattere l'invasore. A quel punto, “subiscono questi enormi cambiamenti metabolici”, afferma l'immunologa Erika Pearce del Max Planck Institute of Immunobiology and Epigenetics di Friburgo, in Germania. Le cellule stimolate non richiedono solo più energia, osserva. Una cellula T attivata può dividersi più volte al giorno, generando rapidamente un esercito di milioni di discendenti. Per sostenere tale mobilitazione, le cellule richiedono anche grandi quantità di materie prime, come i precursori di DNA, proteine ​​e lipidi.

Come esattamente una cellula immunitaria attivata soddisfi la sua enorme richiesta di energia e materiale molecolare dipende dal tipo di cellula che è. Le cellule T helper attivate, che fungono da comandanti immunitari, sembrano seguire il paradigma di Warburg. Misurano il glucosio e aumentano la glicolisi, sebbene aumentino anche il tasso di fosforilazione ossidativa di una quantità minore e consumino più glutammina. Le cellule T citotossiche, che uccidono le cellule tumorali e le cellule soggette a virus, assumono una presa simile. Al contrario, le cellule T regolatorie che sopprimono il sistema immunitario continuano a trarre la maggior parte della loro energia dalla fosforilazione ossidativa, anche dopo che entrano in azione e preferiscono gli acidi grassi rispetto agli aminoacidi e al glucosio.

Le cellule immunitarie fanno anche diverse scelte metaboliche a seconda che si tratti di cellule della memoria, che persistono per anni e ci proteggono dallo ammalarsi dallo stesso patogeno più di una volta, o da cellule effettrici di breve durata specializzate ad attaccare immediatamente i microbi. Le cellule T di memoria, ad esempio, in genere favoriscono la fosforilazione ossidativa e consumano acidi grassi. Le cellule T effettrici, al contrario, aumentano la glicolisi e sono forti utilizzatori di glucosio, una differenza riflessa nei loro mitocondri, gli organelli che fungono da centrali elettriche cellulari, come riportato da Pearce e dai suoi colleghi 2 anni fa.

Risorse di energia alternativa

Le cellule immunitarie attivate cambiano ciò che consumano e quale via metabolica usano per abbattere quel carburante per produrre ATP che trasporta energia. Alcuni tipi si caricano di glucosio, aumentando la glicolisi e consumano più glutammina. Gli acidi grassi rimangono un alimento base per altre cellule, che dipendono ancora dalla fosforilazione ossidativa.



ATP ATP ATP ATP Trifosfato di adenosina mitocondrio Glucosio

Helper T cell

Cellula T citotossica

Cellula T regolatoria

Cellula B. Cella di memoria B o T.

La glicolisi Ripartizione della glutammina Ossidazione degli acidi grassi ciclo di Krebs ossidativofosforilazione glutammina Acidi grassi Cellula Materiali grezzi Glucosio Aumenta l'assunzione Ridurre l'assunzione glutammina Acidi grassi N 0 0 0 0 N 0

Sebbene le cellule T della memoria “abbiano questi mitocondri belli, intatti, filiformi”, dice, le cellule T effettrici tritano i loro mitocondri. Gli organelli sono i luoghi in cui avviene la fosforilazione ossidativa e la loro rottura può rendere meno efficiente la via metabolica e promuovere la glicolisi, suggeriscono i ricercatori.

Gli adattamenti metabolici consentono alle cellule immunitarie di svolgere i loro ruoli protettivi, ma a volte portano a malfunzionamenti delle cellule. Nell'artrite reumatoide, ad esempio, le cellule T attivate scivolano nelle articolazioni, afferma l'immunologa Cornelia Weyand dell'Università di Stanford a Palo Alto, in California. “A loro piace lì, e rimangono e causano infiammazione cronica dei tessuti.”

Tale comportamento riflette un cambiamento nel metabolismo. Come altre cellule T attivate, le cellule T implicate nell'artrite reumatoide si basano sulla glicolisi. Ma modificano quel percorso per rendere meno ATP e più precursori molecolari necessari per supportare la loro rapida divisione. Di conseguenza, le cellule T sono a corto di specie reattive dell'ossigeno – molecole di segnalazione chiave che controllano il loro comportamento – e diventano canaglia. Accelerano la loro riproduzione e si specializzano in varietà che promuovono l'infiammazione.

Le cellule diventano anche ginnaste migliori, abili a strisciare attraverso spazi ristretti nelle articolazioni. Weyand e i suoi colleghi hanno scoperto che le cellule T anomale hanno prodotto delle increspature sulle membrane cellulari che hanno permesso loro di penetrare più a fondo nei tessuti. All'interno dell'articolazione, le cellule T mobili aiutano a stimolare altre cellule a formare una lesione che ricorda una ferita non cicatrizzante, afferma Weyand, e che provoca dolore e ulteriore deterioramento dell'articolazione. “Il metabolismo della cellula controlla il suo comportamento e il suo comportamento non è buono per il paziente”, afferma.

Pearce afferma che la prospettiva di intromettersi con il metabolismo delle cellule immunitarie per curare le malattie spaventa alcuni dei suoi colleghi, che temono di paralizzare l'intero sistema di difesa del corpo o di danneggiare altre cellule vitali. “Se dai un inibitore della glicolisi, non ucciderà qualcuno?” le chiedono. Ma l'immunologo Jeff Rathmell del Vanderbilt University Medical Center di Nashville afferma che solo una piccola parte delle cellule immunitarie – e delle cellule del corpo in generale – aumenta il loro uso di tali percorsi e sarebbe influenzata dai farmaci che alterano il metabolismo. “Alla maggior parte delle cellule non importa.”

Il lavoro sugli animali suggerisce che il targeting del metabolismo immunitario è un approccio promettente. In uno studio del 2015, l'immunologa Laurence Morel dell'Università della Florida a Gainesville e colleghi hanno dosato topi che sono stati geneticamente modificati per sviluppare una condizione simile al lupus con metformina e 2DG. La metformina riduce la fosforilazione ossidativa, mentre il 2DG sopprime la glicolisi. Insieme, le molecole hanno invertito i sintomi del lupus negli animali. I pazienti con lupus, ad esempio, pompano anticorpi che attaccano il proprio DNA. Ma nei topi, i livelli di quegli anticorpi sono diminuiti di circa il 50% dopo l'inizio del trattamento. I ricercatori non hanno rilevato segni che i roditori siano diventati più vulnerabili alle infezioni.

In un altro studio, Rathmell e colleghi hanno aggiunto il dicloroacetato, che sopprime la glicolisi, all'acqua potabile dei topi che hanno una condizione che imita la sclerosi multipla, in cui il sistema immunitario attacca la guaina mielinica isolante dei nervi. Il composto ha impedito la distruzione della mielina negli animali e ridotto i sintomi neurologici come la debolezza muscolare, hanno riferito gli scienziati nel 2014.

Anche il metabolismo cellulare che ostacola potrebbe frenare gli attacchi del sistema immunitario agli organi trapiantati, hanno scoperto Powell e colleghi. Hanno dato metformina, 2DG e un terzo farmaco che blocca il metabolismo della glutammina nei topi che avevano ricevuto innesti di pelle o trapianti di cuore. Gli innesti di pelle sono sopravvissuti circa quattro volte più a lungo nei topi trattati rispetto agli animali di controllo, il che ha rapidamente respinto il tessuto. I cuori trapiantati hanno anche funzionato molto più a lungo nei topi che hanno ricevuto il trio di droga, ha riferito il team nel 2015 Rapporti cellulari.

I pochi studi clinici che hanno testato il concetto nelle persone hanno utilizzato principalmente composti già approvati come la metformina. Due anni fa, i ricercatori argentini hanno riportato un minor numero di nuove lesioni cerebrali in 30 pazienti con sclerosi multipla che hanno assunto metformina o un altro farmaco che cortocircuita la fosforilazione ossidativa. Uno studio clinico condotto da ricercatori cinesi sta testando se la metformina può sedare i razzi del lupus. E finora, tali droghe sembrano sicure. “La metformina da sola fa ben poco per ridurre l'immunità, ad esempio, ma può ridurre l'infiammazione cronica”, afferma Rathmell.

Gli scettici osservano che i ricercatori hanno anche cercato di riutilizzare la metformina e il 2DG per bloccare il metabolismo nelle cellule tumorali, con risultati incoerenti. Tuttavia, Powell e altri scienziati affermano di non essere scoraggiati. Contrariamente alle cellule tumorali, “In realtà non è necessario uccidere una cellula (immune) per modificarne il metabolismo”, afferma Rathmell.

Questi farmaci non sono stati progettati per modificare il metabolismo delle cellule immunitarie, aggiunge il biologo del cancro Ralph DeBerardinis del Southwestern Medical Center dell'Università del Texas a Dallas. “Non dovremmo essere sorpresi se non hanno la potenza o la specificità per avere un effetto significativo.”

Non è necessario uccidere una cellula (immune) per modificarne il metabolismo

Jeff Rathmell, Centro medico dell'Università di Vanderbilt

Alcuni scienziati pensano che parlare di trattamenti sia prematuro. Inibire le reazioni che producono energia delle cellule immunitarie in una malattia cronica “è un'idea allettante”, afferma il biologo mitocondriale Navdeep Chandel della Feinberg School of Medicine della Northwestern University a Chicago, Illinois. Ma sostiene che i ricercatori non capiscono abbastanza bene il metabolismo delle cellule immunitarie da sapere come intervenire in modo sicuro ed efficace.

Eppure uno studio pubblicato online questa settimana in Scienza fornisce un maggiore supporto che inibire il metabolismo immunitario può placare le malattie umane. Il lavoro si concentra su un farmaco, dimetilfumarato, che ha già ricevuto l'approvazione dalla Food and Drug Administration degli Stati Uniti come trattamento per la sclerosi multipla. Sebbene i ricercatori sapessero che il farmaco sopprime le cellule immunitarie, non erano sicuri di come. Un team guidato da scienziati di John Hopkins riferisce ora che il composto paralizza un enzima necessario per la glicolisi, rafforzando l'idea che il percorso possa essere preso di mira dai farmaci.

Glick è fiducioso che lui e gli altri siano impegnati in qualcosa. Il composto che ha scoperto risale alla ricerca che iniziò a metà degli anni '90. “In un certo senso ho sostenuto”, dice. Glick e i suoi colleghi erano alla ricerca di composti che uccidessero le cellule B, le cellule produttrici di anticorpi che aiutano a causare i sintomi del lupus. Dopo aver testato diversi composti, ne hanno trovato uno che ostacola un enzima necessario per la fosforilazione ossidativa.

Lycera sta valutando una versione migliorata di quella molecola nelle persone con psoriasi o colite ulcerosa in parte perché è più facile testare farmaci su quelle malattie che sul lupus, i cui sintomi influenzano più organi e sono più difficili da rintracciare. A differenza dell'adalimumab che Jeremy Glick inietta, questo farmaco può essere assunto sotto forma di pillola. Lycera prevede di annunciare i risultati delle sue due prove entro la fine dell'anno.

Questo mese, una nuova società fondata da Gary Glick ha avviato studi clinici su un farmaco antiparassitario esistente, la niclosamide, in pazienti con colite ulcerosa. La niclosamide, che uccide la tenia inibendo la fosforilazione ossidativa, ha un lungo record di sicurezza, osserva Glick. “È approvato per i bambini e le donne in gravidanza”, afferma.

Glick era alla ricerca di composti che aggiustassero il metabolismo delle cellule immunitarie anni prima che a suo figlio venisse diagnosticata la malattia di Crohn, ma afferma che la malattia di Jeremy forniva una motivazione in più. “Se potesse svegliarsi ogni mattina e prendere una pillola inventata da papà, sarebbe elettrizzato”, dice Glick.

Psorilax:Tutorial gratuito |la migliore crema contro la psoriasi

0

Psorilax: prezzo, funziona, recensioni, opinioni, come si usa

p38α signaling in psoriasis

Psoriasis is an autoimmune skin condition that is linked to the proinflammatory cytokines IL-23, which triggers epidermal hyperplasia, and IL-17, which is produced by T cells in the skin. Zheng et al. found that p38α signaling specifically in skin-resident dendritic cells known as Langerhans cells was important for the pathogenesis of psoriasis in a mouse model of the disease. p38α signaling in Langerhans cells stimulated the production of IL-23, which is critical for the development of IL-17–producing T cells that are implicated in the disease. Genetic deletion or pharmacological inhibition of p38α reduced skin inflammation in mice with established psoriatic disease. Together, these data identify an important cellular source of pathogenic IL-23 and suggest that p38α in skin-resident Langerhans cells could be targeted to treat psoriasis.

Abstract

Dendritic cells (DCs) contribute to psoriasis pathogenesis. In a mouse model of imiquimod-induced psoriasiform skin inflammation, we found that p38α activity in Langerhans cells (LCs), a skin-resident subset of DCs, promoted the generation of T cells that produce IL-17, a proinflammatory cytokine that is implicated in autoimmune disease. Deletion of p38α in LCs, but not in other skin or circulating DC subsets or T cells, decreased T cell–mediated psoriasiform skin inflammation in mice. The activity of p38α in LCs specifically promoted IL-17 production from γδ and CD4+ T cells by increasing the abundance of IL-23 and IL-6, two cytokines that stimulate IL-17 secretion. Inhibition of p38 activity through either pharmacological inhibition or genetic deletion also reduced the severity of established psoriasiform skin inflammation. Together, our findings indicate a critical role for p38α signaling in LCs in promoting inflammatory responses in the skin and suggest that targeting p38α signaling in LCs may offer an effective therapeutic approach to treat psoriasis.

INTRODUCTION

Psoriasis is a common chronic inflammatory skin disease characterized by epidermal hyperplasia, erythematous plaque formation, and the inflammatory cell infiltration in the dermis and epidermis (1, 2). Psoriasis is traditionally regarded as a local skin disease, but it is also associated with many systemic inflammatory diseases, such as diabetes and cardiovascular disease (3). The etiology and pathogenesis of psoriasis are not fully understood, and accumulating evidence indicates that immune dysfunction plays pivotal roles in disease development (3, 4). Psoriasis was initially classified as a disease mediated by the T helper type 1 (TH1) cell response; however, cytokines released by interleukin-17 (IL-17)–producing T cells such as IL-17, tumor necrosis factor–α (TNFα), IL-23, and IL-22 appear to be critical for the development of psoriasis (3, 57). Many of these cytokines are increased in psoriasis skin lesions (2, 8), and many psoriasis patients have been effectively treated by using a new generation of drugs that selectively target TNFα, IL-23, and IL-17 (9). Although these cytokine antagonists provide higher efficacy, they can cause adverse side effects, such as increased risk of serious infection, cardiovascular disorders, and cancer development in psoriasis patients (10). The TNFα antagonist paradoxically induces new onset psoriasis or aggravates preexisting quiescent psoriatic disease by an unknown mechanism (11). Moreover, these antagonist treatments are costly, and the responses are variable between different psoriasis patients (10). Thus, therapeutic responses could be improved by characterization of the upstream cellular and molecular mechanisms that regulate generation of IL-17–producing T cells during psoriasis pathogenesis.

Dendritic cells (DCs) are the key sentinels of the immune system that bridge innate and adaptive immunity (12) and are critical for the development of psoriasis (13). DCs are a highly heterogeneous population, and different tissues have different DC subsets with different functions (14). Although much effort has been made to identify the precise taxonomy for skin DCs, the current classification for skin DC subsets is still somewhat complicated. There are at least three subsets of DCs in the steady-state human and mouse skin: epidermal Langerhans cells (LCs), dermal myeloid DCs (dDCs), and plasmacytoid DCs (pDCs) (15, 16). According to their surface expression of langerin, mouse dDCs can be further divided into langerin+ dDCs and langerin dDCs (17). Under steady state, langerin+ dDCs are recruited from the blood to the dermis as well as capture tissue antigens and present these antigens to naïve T cells in the draining lymph nodes (DLNs) (17).

In an imiquimod (IMQ)–induced psoriasis-like dermatitis (18), IL-23 produced by either langerin dDCs or LCs drives psoriatic plaque formation in mice (19, 20). Moreover, in an IL-23–induced psoriasis-like mouse skin inflammation (21), monocyte-derived inflammatory LCs and dDCs mediate the disease pathogenesis (22). DC-specific deletion of ABIN-1 (A20 binding and inhibitor of nuclear factor κB 1) restricts Toll-like receptor–induced IL-23 production and protects mice from IMQ-induced psoriasis (23). IL-36 mediates the DC-keratinocyte (KC) cross-talk in an IMQ-induced psoriasiform dermatitis by regulating the IL-23/IL-17/IL-22 pathway, but the in vivo cellular source of IL-36 in psoriasis pathogenesis still needs to be clarified (24). In addition, retinoic acid–inducible gene I (RIG-1)–antiviral signaling drives endogenous IL-23 production in DCs to further promote psoriasis-like disease (25). Thus, despite strong evidence implicating DCs in psoriasis, the intracellular signaling pathways that regulate proinflammatory cytokines in psoriasis pathogenesis remains to be established.

Increased activity of p38α mitogen-activated protein kinase, a central regulator of inflammatory responses, is associated with susceptibility to psoriasis in humans (26) and is characteristic of psoriatic skin lesions (27). p38 activity is also increased in KCs stimulated by stress stimuli, such as cytokines and ultraviolet irradiation (28). These findings indicate that targeting p38 could be a promising strategy to treat psoriasis (29). Unfortunately, p38 inhibitors have not shown efficacy in the treatment of psoriasis, and many have been withdrawn from clinical trials because of adverse side effects (28). Thus, it would be useful to define the cell types in which p38 is active in psoriasis.

Using a combination of genetic and molecular approaches, we report here that p38α deletion in LCs, but not in other DC subsets or T cells, reduced IMQ-induced psoriasiform skin inflammation. Mice with p38α-deficient LCs produced much less IL-23 and IL-6 in response to IMQ treatment. Consequently, when challenged with IMQ, mice with a DC-specific deficiency in p38α showed reduced IL-17 production from γδ and CD4+ T cells. p38α signaling in LCs specifically promoted IL-17 production in γδ and CD4+ T cells through secretion of IL-23 and/or IL-6. However, p38α signaling in LCs was dispensable for the generation of interferon-γ (IFNγ)–, IL-4–, and Foxp3-expressing T cells. Intradermal injection of IL-23 restored the skin inflammation and proinflammatory cytokine expression in mice lacking p38α in DCs. In contrast, IL-6 injection partially restored skin inflammation and proinflammatory cytokine expression. Inhibition of p38 activity also reduced the severity of an established psoriasiform skin inflammation. Thus, this study links p38α signaling in LCs and IL-23 or IL-6 with IL-17 production from γδ and CD4+ T cells, and it provides cellular and molecular mechanisms by which p38α regulates susceptibility to psoriasis.

RESULTS

Deletion of p38α in DCs ameliorates IMQ-induced psoriasiform skin disease in mice

In the IMQ-induced mouse psoriasiform skin disease model (18), p38 activity in CD45+ leukocytes was higher in IMQ-treated mouse skin than in control cream-treated mouse skin (Fig. 1A). Because p38α is the dominant p38 isoform that is expressed in immune cells (30), we generated Mapk14fl/flRosa26-Cre-ERT2 mice (referred to as “p38αCreER mice” here, as described in our previous study (30)) to determine the role of p38 in psoriasis pathogenesis and detected efficient deletion of p38α in skin tissue (fig. S1A). We explored the development of IMQ-induced psoriasiform skin inflammation in wild-type (WT) and p38αCreER mice, which were pretreated with tamoxifen to acutely delete p38α in skin tissue. We found that p38αCreER mice had reduced psoriatic symptom severity than WT mice, including ear swelling, epidermal hyperplasia, and skin inflammatory cell infiltration (Fig. 1, B and C), suggesting that p38α signaling could promote the development of IMQ-induced psoriasiform skin inflammation.

Fig. 1 Deletion of p38α in DCs reduces IMQ-induced skin inflammation in mice.

(A) Wild-type (WT) mice were topically treated with imiquimod (IMQ)–containing or control cream for two consecutive days, and the phosphorylation (p) of p38 in skin CD45+ cells was analyzed by flow cytometry (n = 6 mice per group). MFI, mean fluorescence intensity. (B and C) Tamoxifen-pretreated WT and p38αCreER mice were topically treated with IMQ for six consecutive days. Change in ear thickness (left) and disease severity score (right) were recorded (B) (n = 5 mice per group). Histopathological changes in skin tissue of WT (left) and p38αCreER (middle) mice were examined by hematoxylin and eosin (H&E) staining (n = 3 mice per group), and the marked area was magnified (right) (C). Scale bars, 200 μm. (D) p-p38 in skin dendritic cells (DCs) was analyzed by flow cytometry in WT mice topically treated with control or IMQ-containing cream for two consecutive days (n = 6 mice per group). (E to J) WT and p38αΔDC mice were treated with IMQ for six consecutive days. Change in ear thickness (left) and disease severity score (right) (E) (n = 5 mice per group), representative images of H&E staining of skin sections (n = 3 mice per group) (F), the percentages (G) and cell numbers (H) of neutrophils and macrophages in the epidermis (n = 4 mice per group), and the percentages (I) and cell numbers (J) of neutrophils and macrophages in the dermis (n = 4 mice per group). Scale bars, 200 μm. Two-sided Student’s t tests (right panels of (A), (B), (D), and (E); (G) to (J)) and two-way analysis of variance (ANOVA) (left panels of (B) and (E)) were performed, and data are means ± SEM. Data are representative of three (A to D) or four (E to J) independent experiments.

Consistent with the role of DCs in psoriasis development (13), IMQ-treated mouse skin had an increased percentage and number of DCs than control cream-treated skin (fig. S1B). In addition, p38 activity was higher in IMQ-treated skin DCs (Fig. 1D), suggesting that p38α signaling in DCs might play a pivotal role in the immune mechanisms during psoriasis development. To delineate the specific role of DC-intrinsic p38α signaling in psoriasis pathogenesis, we generated Mapk14fl/flCD11c-Cre mice (referred to as “p38αΔDC mice” here (30)). We observed efficient deletion of p38α in skin DCs (fig. S1C), which did not affect the percentages or activation status of DCs in either the epidermis or dermis (fig. S2, A and B). When treated with IMQ-containing cream, p38αΔDC mice had much less ear swelling and reduced composite psoriasis score than WT mice (Fig. 1E). Histological analysis showed that the skin of p38αΔDC mice had less epidermal hyperplasia and inflammation (Fig. 1F). Flow cytometry analysis showed that the infiltration of neutrophils and macrophages in the skin was increased after IMQ treatment (fig. S3, A and B). However, infiltration of neutrophils and macrophages into the epidermis and dermis was reduced in p38αΔDC mice (Fig. 1, G to J). Notably, the percentages and cell numbers of LCs, CD4+ T cells, and γδ T cells, which are key producers of IL-17 during psoriasis, were comparable in the epidermis of IMQ-treated WT and p38αΔDC mice (fig. S3, C and D). Furthermore, there were no significant differences in neutrophil or macrophage numbers in the spleens of IMQ-treated WT and p38αΔDC mice (fig. S3, E and F). Collectively, these findings implicate a key role for DC-mediated p38α signaling in IMQ-induced psoriatic skin disease.

p38α activity in DCs regulates the generation of IL-17–producing T cells in the skin

Consistent with the critical role of IL-17–producing T cell–mediated inflammatory responses in psoriatic disease pathogenesis (3), the skin tissues from IMQ-treated p38αΔDC mice had lower expression of various related cytokine and chemokine mRNAs, such as Il17a, Tnfa, Il6, Il1b, Il23a, Csf2, and Cxcl1 (Fig. 2A). However, expression of Ifng, Il12a, Il4, Il10, Tgfb1, and Foxp3 was similar to that in WT mice (Fig. 2A). Although IL-22 plays an essential role in inflammatory skin disorders, including psoriasis (3134), the expression of Il22 mRNA was comparable between WT and p38αΔDC mice (Fig. 2A). Moreover, certain genes encoding antimicrobial peptides such as S100a7a and S100a8, and genes responsible for KC proliferation including Krt16 and Krt17, were also significantly decreased in p38αΔDC mice (Fig. 2A and fig. S4A). Consistent with the mRNA expression data, enzyme-linked immunosorbent assay (ELISA) showed that IL-17, TNFα, IL-1β, and IL-6 production was lower in skin tissue from IMQ-treated p38αΔDC mice (fig. S4B). We found by flow cytometry that CD45+ cells, especially γδ T cells, were a major source of IL-17 both in the epidermis and dermis (fig. S5, A and B), as previously demonstrated (5). The expansion of IL-17–producing γδ T cells was greater than that of αβ T cells in both the epidermis and dermis of WT mice (fig. S5, C and D), and the extent of this expansion was decreased in p38αΔDC mice (Fig. 2, B to E). The decreased IL-17 production from CD4+ and γδ T cells was also observed in the DLNs of p38αΔDC mice, whereas the frequencies of IFNγ+ and Foxp3+ CD4+ T cells were similar in the two groups of mice (fig. S5, E and F). WT and p38αΔDC mice had comparable Ki-67 and active caspase-3 staining in both γδ T cells and CD4+ T cells upon IMQ treatment (fig. S6, A and B), indicating that p38α deficiency in DCs did not affect T cell proliferation and survival. These results demonstrate that p38α signaling in DCs is specifically important for the generation of IL-17–producing T cells in mouse skin upon IMQ treatment.

Fig. 2 p38α activity in DCs is required for the generation of IL-17–producing T cell in vivo.

WT and p38αΔDC mice were topically treated with IMQ for six consecutive days. (A) Relative mRNA expression of inflammation-related genes in skin tissue was examined (n = 5 mice per group). ns, not significant. (B and C) The percentages (B) and cell numbers (C) of interleukin-17–positive (IL-17+) γδ T cells in the epidermis and dermis (n = 6 mice per group). γδTCR, γδ T cell receptor. (D and E) The percentages (D) and cell numbers (E) of IL-17+ CD4+ T cells in the epidermis and dermis (n = 6 mice per group). Two-sided Student’s t tests were performed, and data are means ± SEM. Data are representative of three independent experiments.

p38α activity in LCs is important for the generation of IL-17–producing T cells and the pathogenesis of psoriasis

We next sought to identify the DC subsets in mouse skin in which p38α signaling is important for psoriasiform skin inflammation. For this, we transplanted bone marrow (BM) cells of WT or p38αΔDC mice into x-ray–irradiated WT or p38αΔDC mice to generate WT→WT, WT→p38αΔDC, p38αΔDC→WT, and p38αΔDC→p38αΔDC chimeras. Two months after transplantation, chimeras were treated with IMQ to induce psoriasiform skin disease. Compared with IMQ-treated WT→WT chimeras, WT→p38αΔDC chimeras showed decreased ear thickness and composite psoriasis scores (Fig. 3A and fig. S7A). Histological analysis showed that the skin of WT→p38αΔDC chimeras had substantially less epidermal hyperplasia and inflammation (Fig. 3B). Flow cytometry analysis showed that WT→p38αΔDC chimeras had diminished infiltration of neutrophils into the epidermis and dermis (Fig. 3C and fig. S7B). Intracellular staining also showed lower IL-17 production from γδ and CD4+ T cells in the DLNs of WT→p38αΔDC chimeras than did those from WT→WT chimeras (Fig. 3D and fig. S7C). Moreover, skin samples from WT→p38αΔDC chimeras exhibited lower expression of Il17a, Tnfa, Il6, Il1b, and Cxcl1 mRNA expression than WT→WT chimeras (Fig. 3E). Because LCs are resistant to x-ray irradiation (35) and both WT→WT and WT→p38αΔDC chimeras contained the same dDC and circulating DC subsets but different LCs, these results indicate that p38α signaling in LCs is important for IMQ-induced psoriasiform skin inflammation.

Fig. 3 p38α signaling in LCs is important for the development of IMQ-induced skin inflammation.

Bone marrow (BM) cells of WT or p38αΔDC mice were transplanted into x-ray–irradiated WT or p38αΔDC mice, respectively, to make the WT→WT, WT→p38αΔDC, p38αΔDC→WT, and p38αΔDC→p38αΔDC chimeras. The chimeras were topically treated with IMQ for six consecutive days. (A) Change in ear thickness (n = 6 mice per group). (B) Representative images of H&E staining of skin section (n = 3 mice per group). Scale bars, 200 μm. (C) The percentages of neutrophils in the epidermis and dermis (n = 6 mice per group). (D) The percentages of IL-17+ γδ T cells and IL-17+ CD4+ T cells in the draining lymph nodes (DLNs) (n = 6 mice per group). (E) The relative expression of inflammation-related genes in skin tissue (n = 6 mice per group). Two-way ANOVA with Bonferroni post tests (A) and one-way ANOVA with Bonferroni post tests (C to E) were performed, and data are means ± SEM. Data are representative of two independent experiments.

When transplanting WT or p38αΔDC BM cells into x-ray–irradiated WT mice, we found that both IMQ-treated WT→WT and p38αΔDC→WT chimeras had comparable ear thickness and composite psoriasis score (Fig. 3A and fig. S7A), histological changes (Fig. 3B), as well as similar infiltration of neutrophils into the epidermis and dermis (Fig. 3C and fig. S7B). The IL-17 production from γδ and CD4+ T cells in the DLNs was comparable (Fig. 3D and fig. S7C). Moreover, mRNA expression of Il17a, Tnfa, Il6, Il1b, and Cxcl1 was comparable between WT→WT and p38αΔDC→WT chimeras (Fig. 3E). In addition, we found that WT→p38αΔDC and p38αΔDC→ p38αΔDC chimeras had comparable skin inflammation and cytokine production upon IMQ treatment (Fig. 3, A to E, and fig. S7, A to C). Thus, our results clearly show that p38α activity in host radioresistant LCs, but not in dDCs, is important for the generation of IL-17–producing T cells and the pathogenesis of psoriasis.

Signaling through p38α in LCs promotes IL-17–producing T cell generation and psoriasis pathogenesis by regulating the expression of IL-23 and IL-6

To assess whether p38α signaling in LCs stimulates T cells to produce IL-17, we cultured LCs from WT and p38αΔDC mice with γδ T cells in the presence of R848 for 48 hours. γδ T cells cocultured with p38αΔDC LCs produced significantly less IL-17 than did those cocultured with WT LCs (Fig. 4A). To determine whether p38α mediates LC–T cell cross-talk by driving the lineage differentiation of antigen-specific naïve precursors, we cultured naïve CD4+ transgenic T cells specific for ovalbumin (OT-II) together with LCs isolated from WT and p38αΔDC mice in the presence of cognate antigen and R848 for 5 days. Fewer T cells cocultured with p38αΔDC LCs developed into IL-17+ cells than did those cocultured with WT LCs (Fig. 4B). This effect was associated with lower Il17a mRNA expression in T cells activated by R848-pulsed p38αΔDC LCs, but comparable mRNA expression of Ifng, Il4, and Foxp3 (fig. S8A). These results indicate that p38α in LCs stimulates IL-17 production in T cells in vitro.

Fig. 4 Signaling by p38α in LCs controls IL-17–producing T cell generation and skin inflammation by regulating the expression of IL-6 and IL-23.

(A) IL-17 production in the supernatant of γδ T cells cocultured with R848-stimulated WT and p38αΔDC Langerhans cells (LCs) for 48 hours (n = 3 biological replicates). (B) The differentiation of TH17 cells in CD4+ T cells activated with R848-pulsed WT and p38αΔDC LCs for 5 days (n = 3 biological replicates). (C and D) Cytokine expression from WT and p38αΔDC LCs stimulated with R848 for 5 (C) and 24 hours (D) (n = 3 biological replicates). (E) IL-17 production from γδ T cells cocultured with WT and p38αΔDC LCs in the presence or absence of IL-23, IL-1β, or IL-6 (n = 3 biological replicates). (F) Relative mRNA expression of Il17 in CD4+ T cells cocultured with WT and p38αΔDC LCs in the presence or absence of IL-23, IL-1β, or IL-6 (n = 3 biological replicates). (G) Change in ear thickness of IMQ-treated WT and p38αΔDC mice subcutaneously injected with IL-23 or control phosphate-buffered saline (PBS) (n = 5 to 6 mice per group). (H) Change in ear thickness of IMQ-treated WT and p38αΔDC mice subcutaneously injected with IL-6 or control PBS (n = 5 to 8 mice per group). (I and J) Inflammation-related gene expression of IMQ-treated WT and p38αΔDC mice subcutaneously injected with IL-23 (I) or IL-6 (J) (n = 5 mice per group). Two-sided Student’s t tests (A to D and I and J) and two-way ANOVA with Bonferroni post tests (E to H) were performed, and data are means ± SEM. Data are representative of five (A and B), three (C and D and G to J), or four (E and F) independent experiments. Cells used in (A) to (F) were isolated from four to six mice per group.

Next, we explored the molecular mechanisms by which p38α acted in LCs to promote IL-17–producing T cell development. WT and p38αΔDC mice expressed comparable costimulatory molecules, such as CD40, CD80, and CD86 in LCs upon IMQ treatment (fig. S8B). To determine whether p38α signaling in LCs regulates the expression of cytokines that biases IL-17–producing T cell development, we stimulated LCs from WT and p38αΔDC mice with R848 for either 5 or 24 hours. Among the cytokines that potentiate IL-17–producing T cell differentiation, the expression of IL-6, IL-1β, and IL-23 in LCs was lower in p38αΔDC mice than that in WT mice at both mRNA and protein levels (Fig. 4, C and D, and fig. S8C), but the mRNA levels of Il12a, Il27, and Tgfb1 and the protein level of TNFα were comparable in LCs from WT and p38αΔDC mice (Fig. 4, C and D).

To identify the cytokine lost in p38αΔDC LCs that was responsible for reduced T cell IL-17 production, we added back recombinant IL-23, IL-1β, or IL-6 to LC–γδ T cell cocultures. The addition of IL-23 to p38αΔDC LC–γδ T cell cocultures completely restored the defective IL-17 production from γδ T cells, whereas the addition of IL-1β or IL-6 partially or did not restore the defective IL-17 production (Fig. 4E). In LC–CD4+ T cell cocultures, we found that addition of IL-23 or IL-6, but not IL-1β, partially restored Il17 expression in CD4+ T cells activated by p38αΔDC LCs (Fig. 4F). Collectively, these data showed that p38α signaling orchestrated a program for LC-dependent IL-17–producing T cell differentiation.

We sought to further assess the functional importance of p38α-dependent cytokine production in WT and p38αΔDC mice treated with IMQ to induce psoriasiform inflammation. Intradermal injection of IL-23 and IL-6, but not IL-1β, aggravated the severity of IMQ-induced psoriasiform disease (Fig. 4, G and H, and fig. S9A). Injection of either IL-23 or IL-6, but not IL-1β, restored ear swelling in p38αΔDC mice (Fig. 4, G and H, and fig. S9A). In addition, IL-23 injection completely restored expression of Il17a, Tnfa, Il6, Il1b, Il23a, and Cxcl1 in IMQ-treated p38αΔDC mice. In contrast, IL-6 and IL-1β restored expression of some cytokines (Fig. 4, I and J, and fig. S9B). Together, these results showed that p38α mediated the effect on IL-17–producing T cell development and psoriasis pathogenesis through distinct cytokines.

We explored the role of p38α signaling in different DC subsets on cytokine production and IL-17–producing T cell development with R848-stimulated dDCs from WT and p38αΔDC mice. We found that compared with WT dDCs, p38αΔDC dDCs secreted less IL-6 but comparable IL-23 and IL-1β (fig. S10A). Next, we cocultured WT and p38αΔDC dDCs with γδ T or naïve CD4+ T cells and found that CD4+ T cells activated by p38αΔDC dDCs secreted less IL-17, whereas γδ T cells activated by both WT and p38αΔDC dDCs expressed comparable levels of IL-17 (fig. S10, B and C). Because γδ T cells are the major IL-17–producing cells that are critical in IMQ-induced psoriasis (5), p38α signaling in different DC subsets instructs IL-17–producing T cell generation and promotes psoriasis pathogenesis through the regulation of IL-23 expression.

IMQ-induced psoriasiform skin disease does not require p38α in T cells

Although p38α signaling in T cells is not required for TH17 cell differentiation (30), T cell–intrinsic p38α could potentially influence psoriasis pathogenesis by other mechanisms. To evaluate the potential role for T cell–dependent p38α activation in psoriasis, we generated Mapk14fl/flCD4-Cre mice (referred to as “p38αΔT mice” here (30)), which efficiently ablates p38α from T cells (fig. S11A). T cell–specific deletion of p38α did not influence the severity or onset of psoriasis as indicated by comparable disease scores, pathological changes, and immune cell recruitment between IMQ-treated WT and p38αΔT mice (Fig. 5, A to F). Moreover, genetic abrogation of p38α in T cells did not appreciably affect IL-17 production by γδ T cells or the expression of Il17a, Tnfa, Il6, Il1b, Il23a, and Cxcl1 in the skin (fig. S11, B and C). Thus, our results demonstrate that p38α signaling in T cells does not affect IL-17–producing T cell generation or psoriasis development.

Fig. 5 p38α MAPK in T cells is dispensable for the induction of psoriasiform inflammation.

WT and p38αΔT mice were topically treated with IMQ cream for six consecutive days. (A) Change in ear thickness (left) and disease severity score (right) (n = 5 to 6 mice per group). (B) Representative images of H&E staining in skin section (n = 3 mice per group). Scale bars, 200 μm. (C and D) The percentages (C) and cell numbers (D) of neutrophils and macrophages in the epidermis (n = 5 to 6 mice per group). (E and F) The percentages (E) and cell numbers (F) of neutrophils and macrophages in the dermis (n = 5 to 6 mice per group). Two-way ANOVA (left panel of (A)) and two-sided Student’s t tests (right panel of (A); (C) to (F)) were performed, and data are means ± SEM. Data are representative of three independent experiments.

Inhibition of p38 ameliorates psoriasiform skin disease

To evaluate p38α as a potential therapeutic target for the treatment of psoriasis, we examined whether inhibition of p38 activity can alleviate psoriasiform inflammation. When the p38 inhibitor SB203580 was injected into mice that had been previously treated with IMQ, we found that these mice had markedly diminished ear swelling and lower psoriasis disease scores than vehicle-treated mice (Fig. 6A). Histological analysis showed that the skin of SB203580-treated mice had substantially less epidermal hyperplasia and inflammation than vehicle-treated mice (Fig. 6B). The infiltration of neutrophils and macrophages into the epidermis and dermis was also reduced in SB203580-treated mice (Fig. 6, C to F). Moreover, the skin tissues from SB203580-treated mice had lower expression of Il17a, Tnfa, Il6, Il1b, Il23a, and Cxcl1 compared with vehicle-treated mice (Fig. 6G). However, the expression of Il10 and Tgfb1 in skin tissue was not affected by SB203580 treatment (Fig. 6G). IL-17 production by CD4+ and γδ T cells was also decreased in the DLNs of SB203580-treated mice, whereas the frequencies of IFNγ+ and Foxp3+ CD4+ T cells were similar between the two groups (fig. S12, A and B). Because a secondary approach to evaluate whether ablation of p38 signaling can ameliorate established psoriatic disease, we administered tamoxifen to WT and p38αCreER mice to acutely ablate p38α expression on days 5 to 8 post-IMQ exposure. Consistent with our SB2034580 treatment results, we observed substantial reductions in ear swelling, composite psoriasis score, neutrophil infiltration, the production of IL-17 from CD4+ and γδ T cells, and the frequency of IFNγ+ CD4+ T cells in the DLNs in tamoxifen-treated p38αCreER mice (fig. S13, A to C). The frequency of Foxp3+ CD4+ T cells was similar in the DLNs from tamoxifen-treated WT and p38αCreER mice (fig. S13C). These results collectively suggest that inhibition of p38 could offer an approach to treat psoriasis and other inflammatory skin diseases.

Fig. 6 Inhibition of p38 activity reduces disease severity in mice with established skin inflammation.

WT mice were topically treated with IMQ for six consecutive days and received either the p38 inhibitor SB203580 or control vehicle daily by intraperitoneal injection from day 3. (A) Change in ear thickness (left) and disease severity score (right) (n = 6 mice per group). (B) Representative images of H&E staining in skin section (n = 3 mice per group). Scale bars, 200 μm. (C and D) The percentages (C) and cell numbers (D) of neutrophils and macrophages in the epidermis (n = 6 mice per group). (E and F) The percentages (E) and cell numbers (F) of neutrophils and macrophages in the dermis (n = 6 mice per group). (G) Relative expression of inflammation-related genes in skin tissue (n = 6 mice per group). Two-way ANOVA (left panel of (A)) and two-sided Student’s t tests (right panel of (A); (C) to (G)) were performed, and data are means ± SEM. Data are representative of three independent experiments.

DISCUSSION

Although mounting evidence demonstrates essential roles for IL-17–producing T cell–mediated inflammation and DC–T cell cross-talk in the pathogenesis of psoriasis, DC-specific signaling pathways that regulate IL-17–producing T cell responses in the skin still remain poorly defined. Here, we report that p38α signaling in LCs, but not in other DC subsets or T cells, centrally regulated IL-17 production by CD4+ and γδ T cells in IMQ-induced psoriasis model, whereas leaving IFNγ-, IL-4–, and Foxp3-expressing T cell generation unaffected. p38α activity in LCs differentially promoted IL-17 production from γδ and CD4+ T cells by secreting IL-23 and IL-6, respectively. Our findings highlight a crucial role for an axis involving p38α, IL-23, IL-6, and IL-17–producing T cells in psoriasis and suggest that targeting p38α signaling in LCs may provide an attractive treatment for inflammatory skin disease.

The success of IL-17 blockade in the treatment of psoriasis patients underscores the central role of this cytokine in the pathophysiology of psoriasis (9). IL-17 can be secreted by multiple cell types, including CD4+ (TH17), CD8+ (Tc17), γδ+ T cells, innate lymphocytes, and neutrophils (36). The cytokines IL-1β, IL-6, IL-23, and TGFβ (transforming growth factor–β) contribute to the differentiation of TH17 cells (3739), but the importance of these individual cytokines in directing TH17 cell development in vivo still remains controversial and may vary depending on the disease models, environmental factors, or target organs (4042). Our previous work establishes that p38α signaling in splenic DCs stimulates TH17 cell differentiation through the production of IL-6, IL-27, and CD86 expression but is dispensable for IL-1β and IL-23 production (30). In contrast, we showed in the current study that p38α signaling in LCs regulated TH17 cell differentiation independently of Il27 and CD86 expression (Fig. 4C and fig. S8B). Furthermore, we discovered that IL-23 production downstream of p38α signaling contributed to LC-mediated regulation of IL-17 production by γδ T cells. However, p38α was not required for IL-1β and IL-23 production by skin dDCs, which was similar with our previous findings in splenic DCs (30). Thus, the discrepant regulation of specific cytokines by the same intracellular signaling pathway in splenic DCs or dDCs compared to skin LCs further highlights the functional heterogeneity of DCs. Further identification of the molecular pathways that underpin the cell-specific regulation inflammatory responses by p38α is needed to unlock the full clinical potential of DC-targeted therapeutics.

DCs bridge innate and adaptive immunity by capturing antigens and migrating into lymph nodes to initiate protective immune responses (12). Although DC numbers are increased in psoriasis lesions, the results from different groups on the roles of DCs in psoriasis pathogenesis are still controversial because of the usages of different triggers, genetic models, and experimental time points (13, 19, 20, 22, 4348). Our BM chimera results demonstrated that p38α signaling in LCs, but not in other dDCs or inflammatory DCs, was crucial for IL-17–producing T cell development and disease pathogenesis. These results provided genetic evidence supporting the idea of a key proinflammatory function of LCs in psoriasis and that p38α signaling could differentially regulate these effects in distinct cell types.

Because p38 plays an important role in the regulation of numerous proinflammatory responses and disease models (26, 49), p38α has been extensively investigated for the treatment of inflammatory diseases. Although the advance of p38 inhibitors into clinical trials has been halted, further research into the relevant disease mechanisms could improve the clinical development of p38 inhibitors (50). Our results showing that inhibition of p38α activity after the onset of disease reduced psoriasis disease progression suggest that p38 inhibitors could be effective for IL-17–mediated diseases. Moreover, our results imply that selectively targeting p38α inhibitors to LCs ameliorated psoriasis symptoms, suggesting that new drug-delivery vehicles that target p38α inhibitors to specific tissues or cell types could be a promising strategy for avoiding undesirable side effects (51). Local delivery of a p38 inhibitor to the lung reduces inflammation and decreases adverse effects by minimizing exposure of the nontarget organs to the drug (52). Given that current cytokine antagonist biologic treatments are expensive and have considerable adverse side effects (10), targeted delivery of small-molecule p38 inhibitors might provide a potential opportunity to improve psoriasis treatment. Therefore, understanding p38α-dependent regulation of DC functions and subsequent T cell responses might be further exploited for innovative immune therapies.

MATERIALS AND METHODS

Animals

p38αflox and CD11c Cre mice have been described previously (30, 53, 54). Rosa26-Cre-ERT2 and CD45.1+ mice were provided by B. Su (Shanghai Jiao Tong University School of Medicine, China). CD4-Cre mice were provided by H. Wang (Shanghai Jiao Tong University School of Medicine, China). OT-II mice were purchased from The Jackson Laboratory. C57BL/6 mice were purchased from Shanghai SLAC Laboratory Animal Co., Ltd (Shanghai, China). All mice were backcrossed to C57BL/6 background for at least eight generations. Age- and sex-matched mice at 6 to 10 weeks of age were used for all experiments. WT or Cre+ littermate control mice were used where relevant. No adverse effects due to Cre expression itself were observed in vitro and in vivo in these studies. All mice were kept in specific pathogen–free conditions in the Animal Resource Center at Shanghai Jiao Tong University School of Medicine. Animal protocols were approved by Institutional Animal Care and Use Committee of Shanghai Jiao Tong University School of Medicine.

BM chimeras

For BM chimeric experiments, BM cells from WT or p38αΔDC mice were intravenously transferred into lethally irradiated either WT or p38αΔDC mice (5 × 106 BM cells per recipient), respectively. Recipient mice were treated with oral antibiotics for 2 weeks after transplantation.

In vivo tamoxifen treatment

WT and p38αCreER mice were intraperitoneally injected with 2 mg of tamoxifen (Sigma-Aldrich) per mouse for three consecutive days and then rested for 7 days before experiments.

IMQ-induced mouse psoriasiform skin disease model

A cream containing 5% IMQ (3M Pharmaceuticals or MedShine) providing a dose of 25 mg, or control Vaseline (Fagron), was topically applied to the ear of each mouse daily for six consecutive days. Ear thickness was measured daily using a micrometer, and skin inflammation was scored on day 6 on the basis of the extent and severity of erythema, scaling, and thickening according to the clinical psoriasis area and severity index as previously described (18). Briefly, the score was determined as follows: 0 = none, 1 = slight, 2 = moderate, 3 = marked, and 4 = very marked. Erythema, scaling, and thickening were scored independently, and the cumulative score served as the disease severity score (scale, 0 to 12). In some experiments, IMQ-treated mice were intradermally injected with recombinant IL-23 (R&D Systems), IL-6 (BD Biosciences), or IL-1β (R&D Systems) at a dose of 50 ng in 20 μl of phosphate-buffered saline (PBS) per ear on days 0, 2, and 4. Control mice were injected with the same volume of PBS with 0.1% bovine serum albumin (w/v) on the same schedule.

Pharmacological inhibition of p38

IMQ-treated WT mice were intraperitoneally administrated with p38 inhibitor SB203580 (Merck Calbiochem) at a dose of 0.75 mg/kg body weight from days 3 to 5. Liquid SB203580 dissolved in dimethyl sulfoxide (DMSO; MP Biomedicals) was diluted with PBS for injection into mice. The same volume of DMSO was diluted with PBS for injection into control mice.

Skin cell preparation

Mouse ear skin samples were collected and split into dorsal and ventral halves, and then the subcutaneous fat tissue was carefully scraped off and ears were floated split side down for 40 min at 37°C on the surface of 0.5% trypsin (w/v) (Gibco). The dermis was separated from the epidermis. Each sheet was cut into small pieces and placed into digestion solution containing collagenase IV (1.5 mg/ml (for dermis) or 1 mg/ml (for epidermis); Gibco). Digestion was performed for 90 min (for dermis) or 80 min (for epidermis) at 37°C with brief mixing. After the digestion, the solution was mixed thoroughly and filtered through a nylon filter to obtain single-cell suspension.

Cell purification, cultures, and DC cytokine assays

Epidermal LCs, γδ T cells, and naïve CD4+ T cells were enriched with microbeads (Miltenyi Biotec) and sorted with a BD FACSAria III sorter. For LC–γδ T cell coculture, LCs from naïve WT and p38αΔDC mice and γδ T cells from WT mice were mixed in the presence of R848 (1 μg/ml) (InvivoGen). After 48 hours, culture supernatants were collected for ELISA measurements. For LC–CD4+ T cell coculture, LCs from either naïve or IMQ-treated WT and p38αΔDC mice and naïve CD4+ T cells from OT-II mice were mixed in the presence of ovalbumin peptide (10 μg/ml) (OVA323–339) and R848 (1 μg/ml). After 5 days, live T cells were harvested and stimulated with PMA (phorbol 12-myristate 13-acetate; Sigma-Aldrich) and ionomycin (Sigma-Aldrich) in the presence of protein transport inhibitor (BD Biosciences) for 5 hours for intracellular cytokine staining, or with plated-bound α-CD3 (2C11; Bio X Cell) for 5 hours to measure mRNA expression. In some experiments, recombinant IL-23 (20 ng/ml) (R&D Systems), IL-1β (R&D Systems), or IL-6 (BD Biosciences) cytokines were added to the coculture systems. For DC cytokine assays, LCs from naïve or IMQ-treated WT and p38αΔDC mice were stimulated with R848 (1 μg/ml) either for 5 hours before RNA analysis or for 24 hours before ELISA measurement.

Flow cytometry

For analysis of surface markers, cells were stained in PBS containing 2% (v/v) fetal bovine serum with anti-CD45 (30-F11), anti-CD11b (M1/70), anti–Gr-1 (RB6-8C5), anti-F4/80 (BM8), anti-CD11c (N418), anti–MHC-II (M5/114.15.2), anti-EpCAM (G8.8), anti-γδTCR (eBioGL3), anti-CD3 (17A2), anti-CD4 (RM4-5), anti-CD8α (53-6.7), anti-TCRβ (H57-597), anti-CD40 (1C10), anti-CD80 (16-10A1), anti-CD86 (GL1), and 7-AAD (all from eBioscience). For intracellular staining with anti–IL-17 (eBio17B7), anti-IFNγ (XMG 1.2e), anti–IL-23 (fc23cpg), anti–IL-1β (NJTEN3), and anti–IL-6 (MP5-20F3) (all from eBioscience), cells were stimulated with PMA and ionomycin or R848 in the presence of protein transport inhibitor for 5 hours before being stained according to the manufacturer’s instructions (BD Biosciences). For intracellular phosphorylation assays, cells were stained with anti–phospho-p38 (28B10, Cell Signaling Technology) according to the manufacturer’s instructions (BD Biosciences). Staining with anti-Foxp3 (FJK-16S, eBioscience) and anti–Ki-67 (SolA15, eBioscience) were done according to the manufacturer’s instructions (eBioscience). For cell apoptosis analysis, cells were stained with Active Caspase-3 Apoptosis Kit (BD Biosciences). Flow cytometry data were acquired on BD FACSCanto II or BD LSRFortessa X-20 and were analyzed with FlowJo software (Tree Star).

Histopathological analysis

Formalin-preserved mouse ear sections were embedded in paraffin according to standard techniques. Longitudinal sections (6 μm thick) were stained with hematoxylin and eosin and analyzed by microscopic examination.

Protein and RNA analyses

For cytokine detection in skin tissue, 45-mg skin tissue was weighted and homogenized in 0.5-ml ice-cold CelLytic MT Cell Lysis reagent (Sigma-Aldrich). Concentrations of IL-17, TNFα, IL-23, IL-6, and IL-1β in homogenized or culture supernatants were measured by ELISA according to the manufacturer’s instructions (eBioscience). Total RNA of skin tissue and cells was isolated using the TRIzol reagent (Invitrogen) and RNeasy Mini Kit (Qiagen), respectively. Reverse transcription was performed via PrimeScript RT Master Mix (Takara) according to the manufacturer’s instructions. Quantitative polymerase chain reaction (PCR) was carried out with SYBR Green PCR Master Mix (Applied Biosystems) in a Vii7 Real-Time PCR system (Applied Biosystems). Relative mRNA levels were determined with hypoxanthine-guanine phosphoribosyltransferase (HPRT) as a reference gene. The following primers sequences were used: Hprt, TCAGTCAACGGGGGACATAAA (forward) and GGGGCTGTACTGCTTAACCAG (reverse); Il17a, TCAGCGTGTCCAAACACTGAG (forward) and CGCCAAGGGAGTTAAAGACTT (reverse); Tnfa, CAGGCGGTGCCTATGTCTC (forward) and CGATCACCCCGAAGTTCAGTAG (reverse); Il6, CTGCAAGAGACTTCCATCCAG (forward) and AGTGGTAT AGACAGGTATGTTGG (reverse); Il1b, GCAACTGTTCCTGAACTCAACT (forward) and ATCTTTTGGGGTCCGTCAACT (reverse); Il23a, GCCCCGTATCCAGTGTGA (forward) and GCTGCCACTGCTGACTAG (reverse); Csf2, GGCCTTGGAAGCATGTAGAGG (forward) and GGAGAACTCGTTAGAGACGACTT (reverse); Cxcl1, TGCACCCAAACCGAAGTCAT (forward) and TTGTCAGAAGCCAGCGTTCAC (reverse); Ifng, GCCACGGCACAGTCATTGA (forward) and TGCTGATGGCCTGATTGTCTT (reverse); Il12a, CAATCACGCTACCTCCTCTTTT (forward) and CAGCAGTGCAGGAATAATGTTTC (reverse); Il4, GGTCTCAACCCCCAGCTAGT (forward) and GCCGATGATCTCTCTCAAGTGAT (reverse); Il10, CTTACTGACTGGCATGAGGATCA (forward) and GCAGCTCTAGGAGCATGTGG (reverse); Tgfb1, CTCCCGTGGCTTCTAGTGC (forward) and GCCTTAGTTTGGACAGGATCTG; Foxp3, CACCTATGCCACCCTTATCCG (forward) and CATGCGTAAACCAATGGTAGA (reverse); Il22, ATGAGTTTTTCCTTATGGGGAC (forward) and GCTGGAAGTTTGGACACCTCAA (reverse); S100a7a, TGCTCTTGGATAGTGTGCCTC (forward) and GCTCTGTGATGTAGTATGGCTG (reverse); S100a8, TGTCCTCAGTTTGTGCAGAATATAAA (forward) and TCACCATCGCAAGGAACTCC (reverse); Krt16, GGTGGCCTCTAACAGTGATCT (forward) and TGCATACAGTATCTGCCTTTGG (reverse); Krt17, ACCATCCGCCAGTTTACCTC (forward) and CTACCCAGGCCACTAGCTGA (reverse); Il27, CTGTTGCTGCTACCCTTGCTT (forward) and CACTCCTGGCAATCGAGATTC (reverse); and Mapk14, GAGGTGCCCGAACGATAC (forward) and TGGCGTGAATGATGGACT (reverse).

Statistical analysis

The data were analyzed with GraphPad Prism 5 or SPSS 17.0 and are means ± SEM. Analysis of variance (ANOVA) with Bonferroni post test was used for multiple comparisons, and Student’s t test was used when two conditions were compared. P values were indicated, and P < 0.05 was considered significant. Two-sided Student’s t tests and one-way or two-way ANOVA was performed. ns indicates no significance. Error bars represent SEM.

SUPPLEMENTARY MATERIALS

www.sciencesignaling.org/cgi/content/full/11/521/eaao1685/DC1

Fig. S1. p38α deletion in mouse skin tissue and DCs.

Fig. S2. Normal DC development and activation status in the epidermis and dermis of p38αΔDC mice.

Fig. S3. Cell infiltration analysis in the skin and spleen of WT and p38αΔDC mice upon IMQ treatment.

Fig. S4. Gene expression in KCs and cytokine production in skin tissue of WT and p38αΔDC mice upon IMQ treatment.

Fig. S5. Decreased IL-17 production from γδ and CD4+ T cells in the skin and DLNs of p38αΔDC mice.

Fig. S6. The proliferation and apoptosis of T cells in IMQ-treated WT and p38αΔDC mice.

Fig. S7. p38α activity in LCs is important for psoriasiform skin inflammation.

Fig. S8. LC p38α-mediated TH17 cell differentiation and IL-23, IL-1β, and IL-6 expression.

Fig. S9. The effect of p38α signaling in DCs on skin inflammation is IL-1β–independent.

Fig. S10. p38α in dDCs affects IL-17 production from CD4+ T cells but not γδ T cells.

Fig. S11. p38α activity in T cells does not contribute to the IMQ-induced psoriasiform skin inflammation.

Fig. S12. Decreased IL-17 production from γδ and CD4+ T cells in the DLNs upon SB203580 treatment.

Fig. S13. Acute deletion of p38α reduces the severity of an ongoing psoriasiform skin inflammation.

Acknowledgments: We thank J. R. Lukens (University of Virginia, USA) for critical reading and editing of the manuscript and B. Su (Shanghai Jiao Tong University School of Medicine, China) for providing the insightful suggestion. We also thank B. Wang (Shanghai Jiao Tong University School of Medicine, China) for confirming the appropriate statistical tests used in our study. Funding: This work was supported by the National Natural Science Foundation of China (31670897, 81471528, and 91642104 to G.H. and 81671399 to X.L.), the Ministry of Science and Technology of China (973 Basic Science Project 2014CB541803 to G.H.), the Program for Professor of Special Appointment (Eastern Scholar) at Shanghai Institutions of Higher Learning (to G.H.), the Shanghai Municipal Commission of Health and Family Planning (20154Y0120 to R.H. and 20164Y0127 to T.Z.), and the Shanghai Sailing Program (17YF1416600 to T.Z.). Author contributions: T.Z., W.Z., and H. Li designed and performed the in vivo and cellular experiments and contributed to manuscript writing. S.X. and M.H. contributed to gene expression analyses and molecular experiments. H. Liu contributed to chimera experiments. R.H. contributed to animal colony management. Y.L. contributed to histopathology analysis. K.O. contributed mouse models. X.L. provided reagents and contributed to chimera experiments. G.H. designed experiments, analyzed the data, wrote the manuscript, and provided overall direction. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper or the Supplementary Materials.

Psorilax:Rimedio |crema nivea e psoriasi

0

Psorilax: prezzo, funziona, recensioni, opinioni, originale

Con il riscaldamento centralizzato alla massima potenza, togliendo l'umidità dalla pelle, quei cerotti asciutti che hai sviluppato potrebbero aver bisogno di più di una piccola quantità di crema idratante.

Secondo il dott. Ross Perry, direttore medico delle Cosmedics Skin Clinics, una visita su 10 al medico di famiglia è legata alla pelle, e quel numero aumenta mentre lo stile di vita delle persone diventa più stressante.

Qui rivela le 10 condizioni più comuni della pelle e spiega come risolverle.



Una visita su 10 al GP è ora legata alla pelle

1. Sintomi: Macchie di pelle secche, rosse e pruriginose, generalmente osservate dietro le ginocchia e nelle pieghe dei gomiti

Diagnosi: Eczema

Causa: Questo può iniziare a qualsiasi età – durante l'infanzia o l'età adulta. Può funzionare in famiglie o verificarsi in modo casuale ed è collegato con asma e raffreddore da fieno. I fattori scatenanti includono malessere, stress ed esposizione agli allergeni.

Soluzione: Usa creme steroidi idratanti e idrocortisone per controllarlo. “Per fortuna molti bambini crescono a causa dell'eczema, ma per gli adulti può essere un problema permanente che richiede una gestione regolare”, afferma il dott. Perry.

2. Sintomi: Placche secche e squamose di pelle che non sono pruriginose e normalmente si trovano sulla parte anteriore delle ginocchia o all'esterno dei gomiti

Diagnosi: Psoriasi



Idratanti e creme di vitamina D possono aiutare chi soffre di psoriasi

Causa: Si verifica in genere nei giovani adulti dopo un recente mal di gola, ma può anche funzionare in famiglie. Può essere collegato con i sintomi dell'artrite.

Soluzione: Creme idratanti, steroidi e vitamina D. Se grave, il trattamento della luce UVB può aiutare. “La prognosi tende a durare tutta la vita e andrà e verrà con riacutizzazioni quando sei stressato o malato”, afferma il dott. Perry.

3. Sintomi: Macchie pallide di pelle che possono verificarsi su qualsiasi parte del viso o del corpo

Diagnosi: Vitiligine

Causa: Sebbene la causa esatta non sia nota, si ritiene che la vitiligine sia una malattia autoimmune in cui il sistema immunitario del corpo distrugge le cellule che formano i pigmenti note come melanociti.

Soluzione: “Le creme steroidee possono aumentare la produzione di melanina nelle zone più leggere della pelle e i trattamenti leggeri in ospedale possono avere un effetto positivo”, afferma il dott. Perry. “Purtroppo, spesso non si può fare altro che applicare la crema solare sulla pelle circostante per uniformare il colore”.

4. Sintomi: Area verde / gialla scabby rossa, leggermente gonfia che si diffonde rapidamente per alcuni giorni.

Diagnosi: Impetigine

Causa: Questa è un'infezione batterica della pelle altamente contagiosa che si trova più comunemente sul viso, ma può anche apparire su qualsiasi parte della pelle.

Soluzione: “L'impetigine si verifica più comunemente nei bambini piccoli e in età scolare e la condizione può essere molto angosciante perché è così contagiosa e visibile”, afferma il dott. Perry.

“Ma un ciclo di antibiotici orali di solito lo risolve completamente in sette a 10 giorni.”

5. Sintomi: Molteplici macchie rosse gonfie su viso, collo, schiena e petto, spesso con una piccola area di pus alla testa di loro

Diagnosi: Acne

Causa: Legato a un batterio sulla pelle, spesso corre nelle famiglie.

Soluzione: Lavaggi o creme antibatterici, bucce della pelle che creano un ambiente ostile ai batteri, antibiotici orali e trattamenti laser più recenti che possono uccidere i batteri o ridurre il rossore. “Un trattamento efficace e precoce è importante in quanto l'acne può lasciare cicatrici”, afferma Dr Perry. “Stiamo vedendo sempre più acne per adulti adesso.”

6. Sintomi: Rossore arrossato e vasi sanguigni rotti sul viso, in genere le aree delle guance, del naso e del mento

Diagnosi: rosacea



Lo stress e l'alcool possono scatenare la rosacea

Causa: Questa è una condizione infiammatoria che alcuni credono sia causata da anomalie nei vasi sanguigni del viso. Non è contagioso ma risponde ad alcuni antibiotici. I fattori scatenanti includono il consumo di bevande alcoliche e lo stress che può infiammarlo e peggiorare l'aspetto.

Soluzione: Antibiotici per via orale. “I trattamenti con luce laser e pulsata possono essere efficaci nel ridurre il rossore”, afferma Dr Perry.

7. Sintomi: Zone rosse sul viso, sul cuoio capelluto e sul centro del torace con pelle grassa dall'aspetto scaglie spesso nell'attaccatura dei capelli, sopracciglia e lati del naso

Diagnosi: Dermatite seborroica

Causa: Una crescita eccessiva di lievito chiamata malassezia che vive sulla pelle o una reazione eccessiva del sistema immunitario della pelle a questo lievito.

Il dott. Perry spiega: “Questo di solito non è collegato a nessuna malattia di base, può divampare quando sei stanco o stressato ed è più comune nel freddo che nel caldo”.

Soluzione: Lavora dalla testa in giù – usa uno shampoo antifungino e antiforfora contenente il principio attivo nizoral e usa creme antifungine sulla pelle. Le creme steroide delicate possono essere utilizzate per brevi periodi per risolvere qualsiasi irritazione.

“La dermatite seborroica colpisce circa il 4% della popolazione e la forfora – che è una lieve dermatite seborroica del cuoio capelluto – colpisce quasi la metà di tutti gli adulti ad un certo punto della loro vita”, afferma il dott. Perry.

8. Sintomi: Noduli granulosi ruvidi con cime arrotondate ovunque dal viso alle mani

Diagnosi: verruche

Causa: Il virus del papilloma umano.

Soluzione: Rimedi da banco come acidi delicati per bruciare le verruche, nonché trattamenti medici come congelamento e laser. “I trattamenti possono richiedere più sessioni e c'è sempre il rischio che ritornino poiché il virus è presente per tutta la vita nel tuo sistema – ma raramente si mostra sotto forma di verruche”, afferma Dr Perry.

“In periodi di stress hanno maggiori probabilità di tornare e i fumatori sono inclini”.

9. Sintomi: Blister e croste, tipicamente ai bordi della bocca o delle labbra

Diagnosi: Herpes labiale

Causa: Il virus dell'herpes simplex (tipo 1).

Soluzione: Creme antivirali che devono essere applicate non appena il malato avverte un formicolio dove è stata una piaga prima, o non appena appare una nuova vescica o crosta.

“Se sono gravi o ritornano molto frequentemente, le compresse antivirali possono aiutare”, afferma il dott. Perry. “L'herpes simplex è altamente contagioso e ce l'hai per tutta la vita.”

10. Sintomi: Varie: prurito, arrossamento, gonfiore, vesciche e croste

Diagnosi: Allergia



Le reazioni a un allergene possono causare prurito e vesciche

Causa: Reazione a un allergene che può derivare dal contatto diretto o dal consumo di qualcosa.

Soluzione: Rimuovi l'allergene o assicurati di non essere in contatto con la potenziale causa. Quindi trattare i sintomi, spesso con compresse di antistaminici e / o creme steroidi.

“Queste reazioni possono accadere a chiunque e spesso senza che la persona sappia mai l'esatto allergene”, afferma il dott. Perry. “Lo scenario peggiore è quando una reazione allergica scatena sintomi come gonfiore delle labbra o causa difficoltà respiratorie, nota come anafilassi e necessita di cure mediche urgenti.”

Psorilax:Il miglior risparmio per |crema per psoriasi con cortisone leo

0

Psorilax: prezzo, funziona, recensioni, opinioni, dove si compra

Morsi delle pulci nella definizione e nei fatti umani

Immagine di Flea Bites

Immagine di Flea Bites

  • Le pulci sono un insetto parassita che si nutre del sangue di mammiferi e uccelli.
  • La specie di pulci più comune negli Stati Uniti è la pulce di gatto, Ctenocephalides felis.
  • Le “pulci di sabbia” non sono un tipo di fuga. Sono minuscoli crostacei, con un morso simile a quello della pulce di gatto.
  • I morsi delle pulci sugli esseri umani sembrano piccole macchie rosse che spesso si verificano in due o tre gruppi o grappoli con arrossamenti intorno a loro.
  • I sintomi dei morsi delle pulci sugli esseri umani includono
    • macchie rosse con un alone,
    • prurito,
    • orticaria,
    • eruzione cutanea (caratterizzata da piccoli grappoli di protuberanze) e
    • gonfiore intorno al morso.
  • Sintomi di reazioni allergiche ai morsi delle pulci che sono un'emergenza medica e includono difficoltà respiratorie (mancanza di respiro o respiro sibilante), gonfiore delle labbra o della lingua, vertigini, nausea e dolore al petto.
  • L'infezione da morsi di pulci può verificarsi a causa di graffiare i morsi.
  • Le pulci possono trasmettere una serie di malattie, inclusa la peste (Yersinia pestis), bartonellosi, tifo (Rickettsia typhi), tungiasi e tenia delle pulci.
  • Uno dei primi segni di un'infestazione da pulci in casa è quando gli animali iniziano a grattarsi, mordersi o leccarsi eccessivamente.
  • Le pulci possono anche infestare una casa senza animali domestici.
  • I morsi delle pulci possono essere trattati con creme, lozioni o unguenti anti-prurito da banco (OTC). Lavare prima l'area per evitare che l'infezione si diffonda ed evitare di graffiare il morso.
  • I rimedi casalinghi per lenire o alleviare il prurito dai morsi delle pulci includono impacchi di ghiaccio, aloe vera, amamelide, alcol denaturato, aceto, olio dell'albero del tè e bustine di tè usate.
  • Previeni i morsi delle pulci mantenendo i tuoi animali domestici e la casa liberi dalle pulci. Usa un prodotto preventivo contro le pulci sui tuoi animali domestici e mantieni la tua casa pulita e aspirali regolarmente.
  • Potrebbe essere necessario consultare uno specialista del controllo dei parassiti per sbarazzarsi delle pulci.

Puoi prendere la peste bubbonica dal tuo cane?

Le pulci apriranno rapidamente negozi su animali domestici non trattati e i piccoli bastardi possono trasferirti
e la tua famiglia. Le pulci possono anche trasmettere malattie gravi alle persone, per
esempio, la peste bubbonica. I sintomi della peste bubbonica includono:

  • Linfonodi ingrossati, dolorosi e teneri
  • Brividi
  • Febbre
  • Debolezza
  • Mal di testa

Chiedi al tuo veterinario informazioni sui farmaci contro le pulci una volta al mese e metti un mese
promemoria sul tuo calendario per evitare infezioni secondarie da morsi di pulci.

Cosa sono le pulci? Come sono fisicamente?

Le pulci sono un insetto parassita che si nutre del sangue di mammiferi e uccelli. Ci sono circa 2.500 specie di pulci nel mondo. La specie di pulci più comune negli Stati Uniti è la pulce di gatto, Ctenocephalides felis, che infesta anche i cani e può mordere gli esseri umani.

Gli esseri umani possono essere morsi dalle cosiddette “pulci di sabbia”, che di solito si trovano sulla spiaggia e nelle zone costiere. In realtà non sono insetti, ma minuscoli crostacei, sebbene il loro morso sia simile a quello della pulce di gatto. Non infestano le case.

Le pulci adulte sono lunghe da 1/12 a 1/8 di pollice, prive di ali, ovali, piatte da un lato all'altro e di colore bruno-rossastro scuro. Hanno sei gambe lunghe e possono saltare molto in alto e lontano, circa 200 volte la loro lunghezza del corpo. Le larve delle pulci sono di colore bianco pallido e misurano circa 3 mm di lunghezza, simili a minuscoli vermi.

Che aspetto ha un morso di pulce su una persona (immagini)?

I morsi delle pulci sembrano piccoli punti rossi. Questi punti si verificano spesso in due o tre gruppi o grappoli con arrossamento intorno a loro e talvolta un alone leggero. Tendono a mordere gli umani intorno ai piedi, alle caviglie e alla parte inferiore delle gambe.

Per le persone allergiche ai morsi delle pulci, possono esserci aree più grandi di arrossamento e piccole protuberanze simili a brufoli.

Il rossore può durare da poche ore a diversi giorni, a seconda della reazione di un individuo e di quanto (o poco) i morsi vengono graffiati.

Immagine dei morsi delle pulci

Immagine dei morsi delle pulci




PRESENTAZIONE

Cattivi insetti: identifica insetti e punture di insetti
Vedi Presentazione

Quali sono i segni e i sintomi dei morsi delle pulci negli esseri umani?

I sintomi dei morsi delle pulci sugli esseri umani che si verificheranno immediatamente dopo essere stati morsi includono:

  • Macchie rosse con un alone
  • Prurito
  • Orticaria
  • Eruzione cutanea (caratterizzata da piccoli grappoli di protuberanze)
  • Gonfiore intorno al morso

Alcune persone sono più sensibili ai morsi delle pulci e possono avere reazioni allergiche. I sintomi delle reazioni allergiche ai morsi delle pulci includono:

Le reazioni allergiche ai morsi delle pulci possono essere un'emergenza medica, quindi chiama il 911 o recati immediatamente al pronto soccorso di un ospedale.

Morsi di pulci negli esseri umani e morsi di cimici dei letti, hanno lo stesso aspetto?

I morsi delle pulci e delle cimici dei letti sembrano simili, ma non sono la stessa cosa.

  • I morsi delle cimici dei letti spesso sembrano punture di zanzara. Possono essere rossi, sodi e potrebbe esserci un leggero gonfiore intorno al morso. I morsi delle pulci sembrano piccoli grappoli di macchie rosse.
  • I morsi delle cimici dei letti spesso compaiono in file lineari e possono apparire ovunque sul corpo, mentre i morsi delle pulci tendono a essere localizzati in gruppi spesso sui piedi e sulle caviglie.
  • Le cimici dei letti sono notturne e amano fare la loro casa nel tuo materasso, quindi i morsi di questi insetti di solito si verificano di notte quando dormi. Le pulci sono anche notturne ma tendono ad aggrapparsi agli animali domestici e si trovano su mobili, tendaggi e moquette.
  • I morsi delle cimici dei letti possono richiedere diversi giorni per apparire e inizieranno a prudere gradualmente, mentre i morsi delle pulci iniziano a prudere immediatamente e diventano gonfi e rossi entro un'ora dopo il morso.
  • Sia i morsi delle pulci che quelli delle cimici dei letti provocano prurito e possono causare reazioni allergiche.




IMMAGINI

Punture di pulci (negli esseri umani)
Guarda un'immagine di morsi di pulci insieme ad altri morsi e infestazioni
Vedi immagini

I morsi delle pulci provocano prurito? È brutto graffiarli?

Indipendentemente da quanto prurito, cerca di non graffiare i morsi delle pulci. I morsi delle pulci possono prudere intensamente e possono causare un'infezione secondaria. I sintomi di infezione da morsi di pulci includono:

sottoscrivi alla newsletter di MedicineNet su cura e condizioni della pelle

Facendo clic su “Invia”, accetto i Termini e condizioni e l'Informativa sulla privacy di MedicineNet. Accetto inoltre di ricevere e-mail da MedicineNet e comprendo che posso disattivare gli abbonamenti a MedicineNet in qualsiasi momento.

Quali sono i rimedi casalinghi naturali e altri trattamenti utilizzati per i morsi delle pulci negli esseri umani?

I rimedi naturali e casalinghi per lenire o alleviare il prurito dai morsi delle pulci includono:

  • Avvolgere impacchi di ghiaccio (o verdure surgelate) in un asciugamano e applicarli sulla pelle per alleviare il gonfiore e per intorpidire l'area.
  • L'Aloe Vera può alleviare il rossore e il gonfiore.
  • L'amamelide può aiutare con il prurito.
  • L'alcol denaturato può essere utilizzato per asciugare i morsi.
  • L'aceto bianco (diluire 1 parte di aceto con 1 parte di acqua) può fornire un sollievo temporaneo.
  • L'olio dell'albero del tè può alleviare il prurito.
  • Raffreddare le bustine di tè usate nel congelatore e applicare sul morso per alleviare l'infiammazione.

Evita di graffiare i morsi delle pulci perché puoi creare una ferita aperta che lascerà entrare i batteri e può portare a infezioni.

Posso essere infettato dai morsi delle pulci?

L'infezione e la malattia possono derivare dai morsi delle pulci. L'infezione di solito si verifica a causa di graffiare i morsi. Batteri e altri detriti possono essere presenti sotto le unghie e se una persona graffia vigorosamente un morso delle pulci, possono far sì che l'eruzione diventi una ferita aperta per l'ingresso di batteri.

Le pulci possono anche rappresentare una minaccia per la salute pubblica perché possono trasmettere una serie di malattie sia all'uomo che agli animali. Le malattie trasmesse all'uomo dalle pulci includono:

Come puoi prevenire i morsi delle pulci sugli esseri umani?

Poiché la maggior parte dei morsi delle pulci sono dovuti alle pulci portate in casa dagli animali domestici, il modo migliore per evitare di essere morsi è evitare che le pulci si mettano sui tuoi animali domestici.

  • Tieni i tuoi animali domestici lontani dagli animali che sai di aver avuto le pulci di recente.
  • Tieni i tuoi animali domestici lontani da luoghi difficili da trattare come sotto i ponti o le tettoie.
  • Falcia spesso il prato e mantieni l'erba corta.
  • Usa un pettine per pulci per controllare la presenza di pulci nel pelo del tuo animale domestico.
  • Tenere pulita la lettiera e lavare in acqua calda.
  • Aspirare frequentemente tappeti, tappeti e mobili imbottiti, soprattutto nelle aree in cui dormono gli animali domestici e sotto i letti, i divani e dietro i mobili.
  • Spolverare i mobili e le tende e i rivestimenti puliti a secco.
  • Usa una medicina preventiva contro le pulci sul tuo animale domestico una volta al mese (ad esempio, Advantage, Advantix, Frontline, Revolution, Sentinel e altri). Parla con il tuo veterinario del prodotto giusto per il tuo cane o gatto.

Se prendi le pulci sugli animali domestici o in casa presto, è molto più facile sbarazzartene prima che si diffondano in tutta la casa.

Per evitare i morsi delle pulci di sabbia se sei in spiaggia:

  • Evita la spiaggia al mattino presto e nel tardo pomeriggio, quando le pulci di sabbia si nutrono.
  • Usa lettini o sedie piuttosto che un asciugamano o una coperta sulla sabbia.
  • Indossare scarpe e calzini chiusi quando si cammina sulla spiaggia.
  • Usa un repellente per insetti con DEET.
  • Stai lontano dalle alghe, il cibo preferito delle pulci di sabbia.

A partire dal Logo WebMD

Risorse per problemi e trattamenti della pelle
Soluzioni per la salute Dai nostri sponsor

Come posso sapere se ho le pulci in casa mia?

Uno dei primi modi in cui le persone notano di avere un'infestazione da pulci è quando i loro cani o gatti iniziano a grattarsi, mordersi o leccarsi eccessivamente. Puoi usare un pettine antipulci per controllare la pelliccia del tuo animale domestico per pulci e feci delle pulci. Le feci delle pulci sul tuo animale domestico possono sembrare insetti puntiformi o macchie di sporco o pepe.

Una volta che le pulci si sono attaccate agli animali domestici, non ci vuole molto a diffondersi in casa. Una volta che hanno infestato la casa, potresti notare le pulci che saltellano sul tappeto, sui mobili o sui tendaggi.

Se sospetti che il tuo animale domestico o la tua casa possano avere un'infestazione da pulci, puoi testare le macchie scure per vedere se si tratta di feci delle pulci. Inumidisci le sospette feci delle pulci e se diventa di colore rosso o marrone, sono feci delle pulci. (Le feci delle pulci sono costituite da sangue essiccato.) Un altro modo rapido per aiutarti a controllare un'infestazione da pulci è indossare calzini bianchi lunghi. Alle pulci piace saltare sui piedi, sulle caviglie e sulla parte inferiore delle gambe degli umani. Gli insetti sono di colore bruno-rossastro scuro e se ti saltano addosso mentre indossi calzini bianchi saranno più facili da vedere.




IMMAGINI

Eczema
Sfoglia la nostra raccolta di immagini mediche di disturbi cutanei allergici come psoriasi e dermatiti e altro ancora causato da allergie
Vedi immagini

10 rimedi naturali e soluzioni per sbarazzarsi delle pulci sugli animali domestici e nelle case?

Sbarazzarsi delle pulci è un approccio su più fronti. Ci sono alcune soluzioni naturali che possono aiutare a respingerle, tuttavia, se hai un'infestazione è probabilmente meglio consultare uno specialista di rimozione dei parassiti per liberare completamente la tua casa dalle pulci e consultare il tuo veterinario per assicurarti che i tuoi animali domestici siano liberi dalle pulci.

Una volta che ti sei sbarazzato delle pulci, puoi usare alcuni rimedi naturali per evitare che ritornino.

  1. Tratta le aree della casa con soluzioni antimicrobiche come olio dell'albero del tè, spray all'aglio o polvere di farina fossile.
  2. Poche gocce di olio di melaleuca possono essere aggiunte ai prodotti da bagno, oppure può essere usato come spray su biancheria da letto, tappezzeria, tappeti e altri tessuti.
  3. Gli oli essenziali possono essere usati per fare uno spray repellente per pulci fatto in casa. Gli oli comuni utilizzati includono eucalipto, menta piperita, melaleuca, palissandro, cedro, agrumi o citronella. Mescolare con acqua e mettere in un flacone spray.
  4. Usa trappole per pulci fatte in casa per sbarazzarti delle pulci. In una ciotola, aggiungi la stessa quantità di acqua calda e sapone liquido per le mani e posiziona la ciotola ai piedi del tuo letto con una piccola lampada accesa nelle vicinanze. Le pulci sono attratte dal calore della luce e cadranno nella trappola e annegheranno.
  5. Prima di passare l'aspirapolvere, cospargere la polvere di farina fossile e borace su tappeti, moquette e pavimenti. Il borace può essere irritante per la pelle e gli occhi, quindi tienilo lontano dalla portata dei bambini.
  6. Gli alberi di eucalipto sono noti per essere repellenti alle pulci e possono essere piantati nel cortile.

Le bombe delle pulci (nebulizzatori) non si assorbono bene nei tappeti, dove vivono le larve delle pulci. Per questo motivo, la maggior parte degli specialisti del controllo dei parassiti sconsiglia le bombe antipulci perché non le considera efficaci.

Alcuni rimedi naturali che possono aiutare a respingere le pulci negli animali domestici includono:

  1. Aggiungi piccole quantità di lievito di birra e aceto di mele all'acqua potabile del tuo animale domestico per respingere le pulci.
  2. L'aceto di mele diluito può essere utilizzato anche come risciacquo finale per gli animali domestici dopo il bagno.
  3. Gli shampoo a base di erbe per fare il bagno al tuo animale domestico includono eucalipto, lavanda, germanio, limone o melaleuca.
  4. L'aglio aggiunto al cibo del tuo animale domestico può aiutare a respingere le pulci.

Parla con il tuo veterinario dei modi per mantenere i tuoi cani e gatti liberi dalle pulci. Prima di utilizzare qualsiasi rimedio domestico o naturale per la prevenzione / repellenza delle pulci sui tuoi animali domestici, consulta il tuo veterinario. Alcuni rimedi funzionano bene per alcuni animali domestici e non per altri, e alcuni animali domestici potrebbero avere reazioni indesiderate a questi oggetti. La quantità di qualsiasi erba o olio o altro prodotto utilizzato per un animale domestico può variare a seconda delle dimensioni, del peso, dell'età, della razza e della salute generale. È sempre meglio consultare il tuo veterinario per assicurarti che i prodotti e le quantità che usi siano sicuri per i tuoi cani e gatti.

Devo avere un animale domestico per ricevere i morsi delle pulci?

Mentre la maggior parte delle infestazioni da pulci domestiche si verificano nelle case con animali domestici, le pulci possono infestare anche la casa senza animali domestici. Ciò può accadere in diversi scenari.

  • Se ti sei trasferito di recente in una casa in cui i precedenti proprietari avevano animali domestici con le pulci e non sono stati debitamente sradicati, potresti trovarti con un'infestazione da pulci.
  • I mobili usati possono essere infestati dalle pulci.
  • Cani o gatti del vicinato che hanno le pulci possono uscire vicino a casa tua
  • Anche parassiti come ratti o topi o animali selvatici come opossum, procioni, scoiattoli e puzzole possono trasportare le pulci e portarle nella tua casa.

Quali luoghi pubblici possono avere le pulci?

  • Un luogo pubblico comune dove si possono trovare le pulci è nei parchi per cani. Possono anche essere trovati in grandi parchi naturali che ospitano animali selvatici come opossum, procioni, scoiattoli e puzzole che possono trasportare le pulci.

Revisionato dal punto di vista medico 7/10/2019

Riferimenti

Ogg, Barb, PhD. “Controllo integrato delle pulci”. Università del Nebraska-Lincoln.

Dipartimento di Entomologia presso la Purdue University. “Pulci.”

Castells, MC, MD, PhD. “Morsi di insetto.” Aggiornato. Aggiornato: Kim 01, 2017.

Programma di educazione alla sicurezza dei pesticidi della Michigan State University. “Domande e risposte sulle pulci”.

National Park Service US Department of the Interior. “Office of Public Health – Flea Factsheet”.

Fleabites.net “Flea Bites on Humans – Pictures, Treatment and Prevention”.

Psorilax:codice promozionale |crema psoriasi naturale

0

Psorilax: prezzo, funziona, recensioni, opinioni, composizione

Astratto

La relazione tra il sistema immunitario e l'epilessia è stata studiata per lungo tempo. L'attivazione immunitaria può precedere o seguire la comparsa di convulsioni. A seconda della situazione, l'immunità innata e acquisita può essere coinvolta a vari livelli. L'intensa ricerca in corso ha aperto prospettive di gestione e terapeutiche incoraggianti per un numero significativo di pazienti affetti da convulsioni. Questi includono l'uso di vari farmaci e approcci meno convenzionali con proprietà antinfiammatorie o immunomodulanti. I dati per i bambini rimangono scarsi, tuttavia, e le implicazioni pratiche delle recenti scoperte sul campo rimangono da identificare formalmente. Lo scopo di questa revisione è presentare le attuali conoscenze sul ruolo dell'immunità in relazione alle convulsioni, con particolare attenzione ai dati clinici disponibili durante l'infanzia. Più specificamente, vengono discussi vari autoanticorpi coinvolti nell'encefalite autoimmune ed epilessia e ipotesi fisiopatologiche generali sul ruolo dell'immunità nella genesi delle crisi convulsive, vengono sintetizzate le sindromi specifiche dell'epilessia in cui sono stati studiati i componenti autoimmuni, vengono suggerite raccomandazioni di workup e opzioni terapeutiche, e infine, vengono presentate domande aperte e esigenze future.

  • Abbreviazioni:
    Auto-AB
    autoanticorpi
    BBB
    barriera emato-encefalica
    CNS
    sistema nervoso centrale
    CSF
    liquido cerebrospinale
    GAD
    decarbossilasi di acido glutammico
    I L
    interleuchina
    IVIG
    immunoglobulina per via endovenosa
    LE
    encefalite limbica
    NMDA-R
    Recettore del glutammato di N-metile D-aspartato
    RTX
    rituximab
  • Il rischio di nuovi attacchi di insorgenza è particolarmente elevato durante l'infanzia. La prevalenza media di convulsioni ricorrenti non febbrili nei paesi sviluppati è compresa tra 3,5 e 5 per 1000 bambini,1,2 e il tasso di incidenza cumulativa dell'epilessia all'età di 15 anni è ∼0,8%. Nonostante enormi progressi nel campo dell'imaging e della genetica che hanno migliorato la comprensione dei meccanismi patofisiologici sottostanti,> il 60% dei disturbi convulsivi rimane senza una causa identificabile.3

    In un recente studio di ampia portata basato sulla popolazione (N = 2 518 034), i bambini con malattie autoimmuni avevano un rischio complessivo di epilessia 5 volte superiore rispetto ai controlli di età corrispondente.4 Questo rischio è stato costantemente accentuato in tutte le 12 malattie autoimmuni considerate, incluse alcune non note per influenzare la funzione del sistema nervoso centrale (SNC) come la miastenia grave o la psoriasi.4 In alcune di queste situazioni, specifici autoanticorpi (auto-AB) sono stati coinvolti nello sviluppo di segni e sintomi neurologici, ma restano da identificare precisi meccanismi patofisiologici.

    Inoltre, la funzione immunitaria è stata intensamente studiata in numerose malattie neurologiche primarie, tra cui le epilessie comuni per le quali resta da scoprire un'eziologia di base.5 Il riconoscimento dell'importanza dell'immunità nella fisiopatologia delle epilessie è illustrato dall'attuale intenzione della Lega internazionale contro l'epilessia di includere una nuova categoria di eziologia immunitaria nella sua proposta di Organizzazione delle epilessie.6 Nel complesso, la ricerca in corso in questo campo apre prospettive di gestione e terapeutiche incoraggianti per un numero significativo di adulti con convulsioni, ma i dati nei bambini rimangono scarsi.7 Poiché l'identificazione e l'intervento precoci mostrano sempre di più di migliorare il risultato generale, è importante avvisare i pediatri di questo specifico argomento.

    Di conseguenza, questo articolo presenta una panoramica dello stato attuale delle conoscenze sul coinvolgimento dell'immunità innata e adattiva nelle epilessie con un'enfasi sui dati pediatrici disponibili.

    Immunità ed epilessie: recenti progressi nella comprensione di una relazione complessa

    Dall'inizio degli anni '90 si è verificata un'esplosione del numero di studi scientifici sulla relazione tra autoimmunità ed epilessia. In alcune circostanze, l'attivazione immunitaria precede e provoca la comparsa di convulsioni. I dati della ricerca sugli animali indicano che al contrario, in altre situazioni, la cascata infiammatoria può essere attivata dalle convulsioni stesse. È generalmente accettato che un certo grado di reazione immunitaria sia favorevole e contribuisca alla protezione del cervello da danni permanenti dopo convulsioni; in determinate circostanze, tuttavia, questi processi immunitari possono essere deleteri.8 Inoltre, vari auto-AB sono stati associati a condizioni acute o croniche in cui i sequestri sono un segno distintivo, ma spesso non è chiaro se siano patogeni o se rappresentino semplicemente i marker di una malattia di base.

    Auto-AB correlati a convulsioni durante l'infanzia

    Numerosi Auto-AB sono stati oggetto di studio sull'epilessia negli anni passati.9 Di solito vengono identificate due categorie principali di auto-AB in base alla posizione dei loro antigeni target: la superficie intracellulare (probabilmente non patogena) o neuronale (probabilmente patogena). La loro presenza è stata dimostrata nel siero o nel liquido cerebrospinale (CSF) di molti pazienti con convulsioni, ma i ruoli precisi di molti auto-AB rimangono da comprendere appieno, specialmente nei bambini. Un recente articolo di revisione tratta ampiamente questo argomento.10 Conoscenza attuale1138 è sintetizzato nella tabella 1.

    TABELLA 1

    Auto-AB contro bersagli antigenici neuronali riportati nei bambini con convulsioni

    Le sindromi da encefalite autoimmune vengono sempre più definite dal biomarker auto-AB associato, come il recettore del glutammato N-metil D-aspartato (NMDA-R) AB. Tuttavia, molti pazienti con sospetta encefalite autoimmune non hanno un biomarcatore associato e quindi le sindromi cliniche rimangono importanti, la più importante delle quali è l'encefalite limbica (LE). La LE è un'encefalite infiammatoria che colpisce prevalentemente la regione limbica con alterazioni della memoria clinica, convulsioni del lobo temporale e sintomi psichiatrici ed è più comune negli adulti che nei bambini. Le risonanze magnetiche in genere mostrano infiammazione e gonfiore limitati nelle regioni limbiche bilaterali, gli EEG possono mostrare caratteristiche localizzanti e il liquido cerebrospinale può mostrare caratteristiche di infiammazione. Una serie di criteri diagnostici per LE è stata recentemente proposta da Graus et al.39 Diversamente dagli adulti, quando la LE è spesso associata ad auto-AB paraneoplastiche, la LE nei bambini è spesso sieronegativa (sebbene possa essere associata alle auto-AB dell'acido glutammico decarbossilasi (GAD)).17

    Epilessie o condizioni pediatriche specifiche in cui sono stati segnalati Auto-AB o caratteristiche disimmuni

    La maggior parte dei bambini che hanno convulsioni condividono alcune caratteristiche cliniche che probabilmente riflettono una partecipazione del sistema immunitario alle loro malattie.9 Questi includono un cambiamento (principalmente un aumento o, più raramente, una diminuzione) della frequenza delle crisi epilettiche durante periodi di malattie infettive o una risposta favorevole ad alcuni approcci immunoterapici. Alcuni degli auto-AB precedentemente descritti (così come ulteriori auto-AB non diretti principalmente contro obiettivi del SNC), citochinesi elevato e altri marcatori non specifici di un'attivazione immunitaria sono stati trovati in bambini con determinate sindromi da epilessia ben delineate, come Encefalite di Rasmussen,4059 Sindrome di West,21,23,30,60,61 Sindrome di Landau-Kleffner,6269 encefalopatia acuta con stato epilettico immuno-mediato,13,22,7084 e sclerosi temporale mesiale legata a precedenti convulsioni febbrili prolungate8590 (Tavolo 2). I meccanismi patofisiologici dettagliati rimangono da capire.

    TAVOLO 2

    Epilessie pediatriche o condizioni epilettiche in cui sono state segnalate caratteristiche disimmuni

    Vari meccanismi collegano l'attivazione e le convulsioni immunitarie

    È generalmente accettato che l'attivazione del sistema immunitario possa essere sia la conseguenza sia la causa delle convulsioni, che in entrambi i casi possono indurre cambiamenti funzionali permanenti nel sistema nervoso centrale. Questi stessi possono contribuire a generare convulsioni epilettiche.9193 Vari percorsi collegano la risposta immunitaria e le convulsioni. Questi includono risposte sistemiche adattive, come l'attivazione delle cellule T e B e la produzione di auto-AB, e meccanismi innati del sistema nervoso centrale, come l'aumento della produzione di citochine da parte delle cellule gliali attivate osservate in risposta a vari stimoli come le convulsioni. Quest'ultimo meccanismo è un processo recentemente identificato chiamato neuroinfiammazione neurogena, in cui le reazioni infiammatorie innate e adattive e l'attivazione delle cellule vascolari all'interno del sistema nervoso centrale sono innescate dall'attività nelle fibre nervose afferenti primarie o nei neuroni di ordine superiore.94 Sulla base di 5 recenti articoli di sintesi,91,9497 si può tentare di sintetizzare i passaggi più importanti che collegano il sistema immunitario e le convulsioni con i seguenti:

    1. Si verifica una lesione iniziale, nel sistema nervoso centrale o nella periferia, e provoca un'attivazione del sistema immunitario in uno o entrambi i compartimenti (sistemico o neuroinfiammatorio). Sono stati identificati vari eventi in grado di svolgere un ruolo del genere, tra cui infezioni periferiche, malattie autoimmuni, malattie vascolari del SNC (trombosi, emboli ed emorragia), vasculite, neurotrauma, disturbi metabolici, infezioni del sistema nervoso centrale, convulsioni e stato epilettico.

    2. I mediatori infiammatori vengono rilasciati in entrambi i compartimenti o in entrambi, a seconda della natura della lesione iniziale. Questi mediatori includono varie citochine (come l'interleuchina (IL) -1β, IL-6 e il fattore di necrosi tumorale-α), integrano le proteine, i cosiddetti segnali di pericolo (molecole che avvisano il microambiente di una lesione in corso, come gruppo di mobilità box-1 e la sua attivazione del recettore toll-like 4 nei neuroni e nelle cellule gliali), molecole di adesione cellulare, prostaglandine prodotte dall'attivazione della via di segnalazione cicloossigenasi-2 e chemochine. La sovraregolazione di questi mediatori e il loro rilascio da parte dei linfociti nella periferia, o da cellule gliali e neuronali attivate, possono a loro volta provocare la rottura della barriera emato-encefalica (BBB), l'adesione e la penetrazione dei linfociti periferici attivati, delle immunoglobuline e dell'albumina nel cervello ( e, per quest'ultimo, successiva attivazione della via di segnalazione del fattore di crescita trasformante-β), aumento della concentrazione di potassio extracellulare, nonché cambiamenti funzionali nei neuroni, nelle cellule gliali e negli astrociti.

    3. Si verificano cambiamenti funzionali neuronali, che aumentano la suscettibilità convulsiva. Esempi di questi cambiamenti funzionali includono la maggiore espressione di IL-1R1 (bersaglio e mediatore della risposta biologica a IL-1β) nei neuroni; l'attivazione di varie famiglie di chinasi intracellulari, come l'induzione della fosforilazione di una subunità di NMDA-R glutamatergica; l'inibizione del reuptake del glutammato o l'aumento del rilascio di glutammato nello spazio extracellulare da parte degli astrociti; la promozione della riorganizzazione sinaptica; e la disfunzione dei canali ionici. Studi di ricerca sugli animali hanno anche mostrato che alcuni geni che codificano per i mediatori della risposta infiammatoria, come IL-1, IL-6 (e il suo recettore) e IL-1β sono sovraregolati nella fase acuta che segue lo stato epilettico o trauma cranico .8,98

    Tutti questi meccanismi aumentano l'eccitabilità neuronale e abbassano la soglia convulsiva, il che crea un circolo vizioso di maggiore suscettibilità convulsiva. La ricerca sugli animali ha fornito dettagli riguardanti i vari meccanismi per l'epilettogenesi indotta da infiammazione. Questi includono la sopra menzionata maggiore adesione dei leucociti periferici attivati ​​alle cellule endoteliali seguita dalla loro infiltrazione nel sistema nervoso centrale attraverso la riorganizzazione del citoscheletro.99 Queste cellule generano radicali liberi ed enzimi citotossici che, oltre all'ulteriore produzione e secrezione di citochine e chemochine, partecipano alla disfunzione neuronale o alla degenerazione che contribuiscono alla comparsa di una successiva suscettibilità cronica alle convulsioni.95

    D'altra parte, un ruolo neuroprotettivo di CD3+ Le cellule T di controbilanciamento dell'infiammazione innata sono state evidenziate nei topi che soffrono di convulsioni indotte da acido kainico e ippocampi lesionati,100 lasciando così aperta la questione dell'esatto ruolo della risposta adattativa.

    Da un altro punto di vista, la relazione tra BBB e insorgenza di epilessia è stata ampiamente studiata per anni,101105 ma il modo in cui l'interruzione del BBB può provocare l'epilessia cronica rimane compreso in modo incompleto. È stato ipotizzato, ad esempio, che l'interruzione acuta della BBB dopo convulsioni iniziali causi cambiamenti prolungati o permanenti nella permeabilità cerebrale, che costituisce la base dell'eccitabilità neuronale circostante cronica e di ulteriori genesi delle convulsioni.106108 I recenti progressi nella teoria dell'interruzione del BBB aiuteranno probabilmente la nostra comprensione del processo. Bargerstock et al109 ha mostrato che S100B, una proteina astrocitica, viene rilasciata nella circolazione sistemica quando le giunzioni endoteliali BBB vengono interrotte, ad esempio, durante le convulsioni. Questo rilascio può a sua volta indurre una reazione autoimmune sistemica contro il cervello, che è alla base dello sviluppo di condizioni croniche nel sistema nervoso centrale, come l'epilessia e la malattia di Alzheimer. Questi risultati necessitano di conferma.

    Approcci terapeutici e prognosi

    Vari farmaci e molecole con proprietà antinfiammatorie o immunomodulanti hanno dimostrato di ridurre l'insorgenza di ulteriori attacchi epilettici in situazioni cliniche o sperimentali acute e di prevenire lo sviluppo di kindling ed epilessia negli animali.98,110117 I loro meccanismi di azione sono riassunti nella Tabella 3. Come regola generale, le situazioni in cui si trovano auto-AB neuronali e gli antigeni di superficie bersaglio (ad esempio, NMDA-R) hanno un tasso di risposta terapeutica molto più elevato rispetto a quelli in cui gli antigeni sono intracellulari, come GAD.118 I potenziali approcci immunitari per i bambini in varie condizioni epilettiche includono steroidi,119,120 immunoglobulina endovenosa (IvIg),121123 scambi di plasma,124,125 rituximab (RTX), ciclofosfamide e approcci alternativi come la dieta chetogenica, in cui le proprietà antinfiammatorie e neuroprotettive sono probabilmente i principali attori nei suoi meccanismi d'azione.70,97,126128

    TABELLA 3

    Esempi di farmaci e trattamenti con proprietà antinfiammatorie o immunomodulanti che hanno mostrato efficacia sperimentale o clinica nel trattamento delle convulsioni o nella prevenzione dello sviluppo dell'epilessia

    Due meta-analisi sull'uso di IvIg o interventi immunomodulatori in generale nell'epilessia hanno concluso che, sulla base dei dati disponibili, la loro efficacia non poteva essere dimostrata.129,130 Pertanto, rimane aperta la questione se le terapie antinfiammatorie o immunomodulanti debbano essere aggiunte ai classici farmaci antiepilettici in autoimmuni o anche in tutti i tipi di epilessie.

    In un recente studio, Irani et al131 ha riportato una rapida diminuzione e progressiva scomparsa totale delle convulsioni distoniche faciobrachiali nei 9 pazienti con ABs contro gliomi ricchi di leucina inattivati ​​1 proteina che sono stati trattati con steroidi in aggiunta ai farmaci antiepilettici iniziali a cui le convulsioni erano refrattarie.

    Allo stesso modo, Toledano et al132 selezionato 29 su 110 pazienti presso la loro clinica di neuroimmunologia che presentavano convulsioni come grave lamentela. Sono stati inclusi anche bambini di 2 anni. Questi pazienti erano sospettati di avere convulsioni di eziologia autoimmune sulla base della presenza di almeno 1 AB neurale, storia personale o familiare o stimmate fisiche di disturbi autoimmuni e convulsioni frequenti o refrattarie. È stato somministrato il trattamento con infusioni giornaliere di 1 g di metilprednisolone per via endovenosa o IvIg da 0,4 g / kg per 3-5 giorni, seguito da infusioni settimanali per 6-12 settimane alla stessa dose (da sola o in combinazione). Diciotto pazienti hanno risposto con una diminuzione della frequenza delle crisi, che è stata sostenuta nella maggior parte dei casi. Lo studio ha portato prove di classe IV che queste opzioni terapeutiche hanno migliorato il controllo delle crisi.132

    Il ruolo degli agenti che modificano la funzione del sistema immunitario innato e attenuano la neuroinfiammazione, come le cellule staminali mesenchimali mesenchimali che secernono β, la melatonina,133136 sta emergendo. In uno studio recente, la minociclina ha dimostrato di migliorare i comportamenti adattivi di alcuni bambini con sindrome di Angelman, sebbene l'esatto meccanismo d'azione potrebbe essere multifattoriale.137 Resta da valutare se queste molecole abbiano un ruolo da svolgere nella gestione di alcune forme di epilessia. Un altro tema importante e attuale in neuroimmunologia è che la terapia precoce ha maggiori probabilità di essere efficace rispetto al trattamento successivo nell'encefalite autoimmune, che è stato recentemente dimostrato in una revisione approfondita della letteratura.138

    Implicazioni pratiche dei dati disponibili e comprensione attuale nella gestione dei bambini con convulsioni

    Quando si dovrebbe sospettare clinicamente un bambino con convulsioni di eziologia immunitaria?

    Suleiman et al139 ha proposto un diagramma di flusso per avvicinare i bambini con sospetti attacchi autoimmuni. Allo stesso modo, Bien118 ha proposto una tabella dettagliata delle caratteristiche cliniche e paracliniche che dovrebbero stimolare la ricerca di auto-AB nei pazienti con epilessia. Più recentemente, Graus et al39 ha proposto un approccio clinico alla diagnosi di encefalite autoimmune, che ha sottolineato che il sospetto clinico dovrebbe comportare una terapia immunitaria di prima linea piuttosto che attendere i risultati di auto-AB. Sulla base di queste proposte, proponiamo che le analisi della funzione immunitaria debbano essere specificamente prese in considerazione nei bambini se sono presenti 3 di questi 5 criteri (Fig. 1): (1) frequenza insolitamente alta di convulsioni dall'inizio, con refrattarietà precoce ai classici farmaci antiepilettici; (2) ulteriori segni clinici di insorgenza acuta o subacuta, che suggeriscono un coinvolgimento diffuso del SNC (come disturbi psichiatrici o comportamentali, disturbi della coscienza, movimenti anomali o problemi del sonno); (3) la presentazione clinica orienta chiaramente una sindrome associata alla presenza di specifici auto-AB; (4) presenza di una storia personale o familiare di malattia autoimmune; e (5) la presentazione clinica non si orienta a sindromi da epilessia ben circoscritte e rapidamente identificabili, e lesioni strutturali e le malattie infettive, metaboliche o tossiche sono escluse dalla storia e dalle prime ricerche.

    FIGURA 1
    FIGURA 1

    Bambini con convulsioni di sospetta eziologia immunitaria: caratteristiche cliniche suggestive e approccio diagnostico graduale proposto. FLAIR, recupero dell'inversione dell'attenuazione del fluido; T2, tempo di rilassamento trasversale.

    Inoltre, alcune infezioni sono note per scatenare l'encefalite e l'epilessia nei bambini. Alcuni di essi infettano direttamente il cervello e causano un'encefalite virale primaria; d'altra parte, alcuni microrganismi possono indurre un'encefalite autoimmune secondaria, come l'encefalite anti-NMDA-R indotta da herpes simplex o varicella zoster.140142 In alcune di queste sindromi da encefalite infettiva o postinfettiva, ci sono prove di autoimmunità e biomarcatori specifici (come NMDA-R AB), mentre in altre sindromi non esiste un biomarcatore specifico e l'esatto meccanismo infiammatorio non è chiaro. Gli studi sull'epilessia postencefalitica hanno dimostrato che l'herpes simplex e il micoplasma hanno il più alto potenziale per provocare un'epilessia in corso.143,144 In questi studi, gravi indicatori clinici come lo stato epilettico erano fattori di rischio per la successiva epilessia farmacoresistente. Recentemente, l'auto-AB contro il leimodin-1, una proteina intracellulare che si esprime nel tessuto muscolare liscio e nella tiroide ma anche nel citoplasma dei neuroni, è stata trovata nel siero e nel liquido cerebrospinale di alcuni bambini dell'Africa orientale con sindrome di annuendo, un disturbo epilettico finora inspiegabile ed epidemico associato al verme parassita Onchocerca volvulus.145

    La reattività alla terapia immunitaria è indicativa di epilessia autoimmune, ma ciò è possibile solo a posteriori. La variabilità o la multifocalità delle crisi intraindividuali e la storia di neoplasia sono state correlate all'epilessia autoimmune negli adulti e dovrebbero anche essere considerate come caratteristiche suggestive nei bambini. È importante notare che l'assenza di queste caratteristiche non può escludere definitivamente l'epilessia autoimmune.

    Inoltre, alcuni pazienti con encefalite autoimmune non presentano alcun sintomo clinico oltre alle convulsioni.146 È probabile che queste osservazioni siano rare, in particolare durante l'infanzia, e non crediamo che tutti i bambini che presentano convulsioni debbano essere indagati per un'eziologia immunitaria in assenza di altre caratteristiche cliniche o sperimentali che suggeriscono infiammazione.

    Queste limitazioni sottolineano il fatto che lo spettro dell'epilessia autoimmune deve ancora essere definito e sono necessari nuovi CSF o biomarcatori del sangue.

    Come dovrebbe essere indagato un bambino con convulsioni di sospetta eziologia immunitaria?

    Ci sono stati grandi progressi nella nostra comprensione dei ruoli degli auto-AB come mediatori e biomarcatori nell'epilessia autoimmune, ma è probabile che molte sindromi abbiano meccanismi cellulari o immunitari innati che sono scarsamente riconosciuti. Profili di biomarcatori più ampi tra cui citochine e / o chemochine, tecniche molecolari e studi di imaging dei ligandi miglioreranno sicuramente la nostra capacità di identificare l'infiammazione del SNC in futuro.

    Suggeriamo che le analisi del sangue mirate per gli auto-AB più probabili in base alla presentazione clinica, l'uso di biochip (mosaici di cellule che mostrano vari antigeni, come quelli descritti nella Tabella 1),118 e una risonanza magnetica cerebrale con tempo di rilassamento trasversale e sequenze di recupero dell'inversione dell'attenuazione del fluido dovrebbero essere le procedure minime eseguite inizialmente nei bambini con convulsioni di sospetta eziologia immunitaria. Poiché le analisi del sangue possono portare a risultati non specifici (positivi o negativi), è necessario eseguire una puntura lombare per cercare un aumento del numero di proteine ​​o cellule, bande oligoclonali e produzione intratecale di auto-AB. Un ELETTROENCEFALOGRAMMA standard può portare ulteriori indizi in situazioni specifiche, come quando si sospetta l'encefalite NMDA-R ed è presente un modello di pennello δ estremo (sebbene questa funzionalità abbia una bassa sensibilità).26,147 Dovrebbe essere preso in considerazione anche un esame esteso del sangue, del liquido cerebrospinale e delle urine per le malattie autoimmuni sistemiche, specialmente in quelli con coinvolgimento multiorgano (Tabella 4). Questo workup include marcatori di funzionalità epatica e renale, tassi di sedimentazione eritrocitaria, proteine ​​del complemento, vari auto-AB riscontrati nel lupus eritematoso sistemico o vasculitidi, nonché auto-AB associati alla malattia autoimmune della tiroide (che si deve ricordare rappresenta una predisposizione all'autoimmunità e alla malattia autoimmune della tiroide piuttosto che un marker patogeno di epilessia autoimmune). Le ricerche tumorali devono essere eseguite in base al potenziale riscontro di auto-AB specificamente associati a tumori maligni, come i teratomi ovarici nelle ragazze con NMDA-R auto-AB. Può anche essere utile la ricerca di marcatori non specifici dell'attivazione immunitaria nel sistema nervoso centrale, come neopterina del CSF o bande oligoclonali.148,149

    TABELLA 4

    Indagine proposta su convulsioni ed epilessia di sospetta eziologia immunitaria

    È urgente sviluppare marcatori affidabili dell'attivazione immunitaria del SNC, che attualmente sono carenti o non ampiamente disponibili. Questi probabilmente includeranno citochine e chemiochine CSF ed EEG o funzionalità di imaging. Un esempio di quest'ultimo è stato fornito di recente da un 11Studio di tomografia ad emissione di positroni di c-acetato di 23 pazienti adulti con epilessia derivante dal lobo temporale in cui è stato dimostrato un aumento del legame di uno di questi marcatori, la proteina traslocatrice 18 kDa, ipsilateralmente e contralateralmente per colpire i fuochi, il che suggerisce un'infiammazione diffusa in corso.150 In un altro studio, il tentativo di rilevare caratteristiche EEG specifiche in pazienti con epilessia e vari AB antineuronali non è riuscito a definire le caratteristiche discriminanti.151 Tuttavia, ci sono indicatori EEG acuti di scarso esito nei bambini con encefalite.152 Pertanto, l'EEG può anche essere utile in termini di prognosi.

    Come dovrebbe essere trattato un bambino con convulsioni di eziologia immunitaria dimostrata (o fortemente sospettata)?

    I classici schemi di trattamento utilizzati in altre malattie neurologiche autoimmuni possono essere applicati anche a convulsioni ed epilessia dell'etiologia immunitaria. Le attuali raccomandazioni per l'encefalite autoimmune, come l'encefalite NMDA-R AB, comprendono metilprednisolone per via endovenosa a 30 mg / kg al giorno per 3-5 giorni (≤1 g) seguita da steroidi pulsati mensili in corso, prednisone orale o prednisolone da 1 a 2 mg / kg al giorno per 2-4 settimane e una conicità lenta.118,139,153 Questo approccio dovrebbe essere preso in considerazione non appena sorge il sospetto di eziologia autoimmune, sia in situazioni croniche che acute.39 Come specificamente dimostrato in condizioni come l'encefalite NMDA-R,153155 trattamento aggressivo compresi ≥4-10 scambi di plasma118 seguito da IvIg a 2 g / kg diviso per 2-5 dosi (o IvIg seguito da scambi di plasma dopo un intervallo minimo di 2 settimane)156 e varie combinazioni di farmaci immunosoppressori (incluso RTX per via endovenosa a 375 mg / m2 ogni settimana, 2-4 volte; e ciclofosfamide endovenosa a 750 mg / m2 mensile per 3-6 mesi)118 dovrebbe essere rapidamente considerato in combinazione con steroidi in gravi malattie.

    È importante sottolineare che questo schema di trattamento è stato proposto per l'epilessia autoimmune e / o l'encefalite e potrebbe non essere efficace in altre sindromi da epilessia disimmune. Dato che l'attivazione immunitaria nel sistema nervoso centrale può essere protettiva, il miglior approccio terapeutico per i pazienti con sospetta ma non confermata epilessia immuno-mediata rimane incerto. Nella Fig. 2, proponiamo uno schema di sperimentazione di immunoterapia che potrebbe essere seguito in futuri studi prospettici di sospetta epilessia immunitaria o autoimmune.138,157

    FIGURA 2
    FIGURA 2

    Una guida alla sperimentazione di terapia immunitaria. La durata della sperimentazione immunitaria dipende dallo scenario clinico. In generale, lo studio terapeutico deve essere sufficientemente lungo per determinare l'effetto e, in condizioni più gravi, lo studio deve essere sostenuto o addirittura ridotto.138,157 Gli steroidi devono essere considerati per tutti i pazienti con sospetta epilessia autoimmune. In casi fortemente sospetti o con provata reattività e / o dipendenza da steroidi, devono essere prese in considerazione altre terapie immunitarie come IvIg, RTX, ciclofosfamide e agenti risparmiatori di steroidi come il micofenolato mofetile.

    conclusioni

    Ora è chiaro che l'infiammazione e l'autoimmunità svolgono un ruolo importante nelle convulsioni e nelle epilessie infantili. Queste reazioni immunitarie possono essere la causa di convulsioni, ad esempio quando vengono prodotti auto-AB contro vari bersagli del SNC coinvolti nell'attivazione neuronale. D'altra parte, varie risposte immunitarie periferiche e del sistema nervoso centrale vengono attivate dopo convulsioni. Questi ultimi meccanismi sono racchiusi nel concetto recentemente descritto di neuroinfiammazione neurogena, che può comportare l'attivazione di una cascata antinfiammatoria e meccanismi omeostatici con conseguente neuroprotezione e interruzione di convulsioni o la perpetuazione di una risposta immunitaria disadattata e neurotossica come base di ulteriore genesi dell'epilessia.94 Le domande importanti che rimangono aperte includono la comprensione dei tempi e della sequenza precisi degli elementi della risposta immunitaria alle convulsioni, il rilevamento di biomarcatori diagnostici affidabili dell'infiammazione del SNC nei bambini con epilessie, l'identificazione di specifiche caratteristiche cliniche, radiologiche ed elettrofisiologiche che possono consentire il sospetto precoce dell'epilessia immunitaria e lo sviluppo di strategie terapeutiche e molecole ottimali mirate contro i vari mediatori infiammatori sopra descritti attraverso studi prospettici controllati.

    Ringraziamenti

    Ci rivolgiamo i nostri più sentiti ringraziamenti al dott. Douglas R. Nordli Jr, a Los Angeles per i suoi utili suggerimenti nelle fasi iniziali del manoscritto.

    Le note

    • Indirizzo per corrispondenza a Christian M. Korff, MD, Unità di neurologia pediatrica, Dipartimento per bambini e adolescenti, Ospedali universitari di Ginevra, 6 Rue Willy-Donzé, CH 1211 Ginevra 14, Svizzera. E-mail: christian.korff at hcuge.ch
    • INFORMATIVA FINANZIARIA: Gli autori hanno indicato di non avere relazioni finanziarie rilevanti per questo articolo da divulgare.

    • FINANZIAMENTO: Nessun finanziamento esterno.

    • POTENZIALE CONFLITTO DI INTERESSI: Gli autori hanno indicato di non avere potenziali conflitti di interesse da rivelare.